GenePrediction:GLEAN_8273 Details

Name: GLEAN_8273
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:184858..184480 (- strand)
Length: 379
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:184858..184685 (- strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_124:184563..184480 (- strand)
Length: 84
>GLEAN_8273 class=GenePrediction position=GCSC_124:184858..184480 (- strand)
ATGCTGACGATAAGCAGGCGGGCCCGAAGGCGGCTCTGTCATTGGCTGCCGGCGGATGGCGGCCCCGCCCCATCGAACCA
CCTGGCGCCACTTGGTGCCGGCCTCCGCCTGGGTGTCGCCCTACGCAGGTCCCCCCCCAATGACGTCGCTGCACAGAAGC
GGAGCTGGCCTTACGTAAGTGCAGATTTTTATCAGGGGCTATCAGTGCAAATCCGGTTTTAGAGGGGGGCCTCTTCCGCA
CCAATGCGCTTTTGTGCAAATTTTCACATCCCTGACCCCATACCCACTACGGCAGCCGGCGCACTACAAGTTCGTCGAGA
TAGCTCTTGAGCAGTATATCGGCTCCACAGCCCATCGGCTCGTATTGCTGCTTTCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62