GenePrediction:GLEAN_8275 Details

Name: GLEAN_8275
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:181898..180973 (- strand)
Length: 926
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:181898..181552 (- strand)
Length: 347
Type: CDS
Source: GLEAN
Position: GCSC_124:181485..181291 (- strand)
Length: 195
Type: CDS
Source: GLEAN
Position: GCSC_124:181233..181199 (- strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_124:181145..180973 (- strand)
Length: 173
>GLEAN_8275 class=GenePrediction position=GCSC_124:181898..180973 (- strand)
ATGGCTCTTAACGGAAAGGTTGCTCTCGTCACTGGCGGAGCCAAGAACCTCGGGGCTGATATCGCCCACGAGCTGGCGTC
GGTCGGGGCCAGCCTGGCGCTGCACTACAACTCGGACAAGACCAAGGCGGACGCGACCAAGACCGAGGCGGCGCTTAAAA
AGGCTTTCCCCAATGTCAAGGTGCGCTTCTACCAGGGCGACCTGACGACGGCCACCGCGGTCGAGAAGCTGTTCGCCTCG
GTCGGGAAGGATTTCGGCGGCATCGACATCGTCGTTAACACGGTCGGCAAGGTGCTGAAGAAGCCCATCACTGAGATCTC
CGAAGAGGAATATGACAGCATGTTTGCGTGAGTCCATTCTCAGAGCTTGGGTTCCTCTCCTCTTCTTACCAGCTAACCGC
CACCGCCGACTAGTGTCAACTCGAAGTCGGCCTTTTTCATTCTCAAGGAGGGGGCAAAGCACGTCAGGGATGGCGGCAAG
ATCGTCACCGTTGTCACTGCCCTGCTAGCTGCTTATACTGGCTACTACACGTCCTACGCCGGCTCCAAGGCGCCTGTGGA
ACACTTCACCCGCGGTGTGTCCAAGGAGCTGCAGCCGCGCGGAGTCAGGTGTGTTTTCTTTCGTAGCCTATTTCCTGTTC
TTCTCATCGATCTAACGGACCGCAGCGTCAACGCCATCGCCCCGGGACCGATGGACACTCGTGAGTTCATTTTCTTTCTT
TTTAATTTCCTATGCTCACATCCACTCTTGTAGCCTTCTTCTACGGCCAGGGTCCTGAGGCCGTTGCTTACCACAAGAGC
CAGGCGCTCGGTGGCCGTCTCACCGACACTAAGGACATTGCTCCCATCGTGCGCTTCCTCGTCACCGAAGGAGGCTGGGT
CACGGGCCAGACAATCTTTGCTAATGGCGGGTACACTACACGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62