GenePrediction:GLEAN_8278 Details

Name: GLEAN_8278
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:171407..169574 (- strand)
Length: 1834
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:171407..171365 (- strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_124:171283..171250 (- strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_124:171196..171106 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_124:171020..170861 (- strand)
Length: 160
Type: CDS
Source: GLEAN
Position: GCSC_124:170809..170271 (- strand)
Length: 539
Type: CDS
Source: GLEAN
Position: GCSC_124:170212..169574 (- strand)
Length: 639
>GLEAN_8278 class=GenePrediction position=GCSC_124:171407..169574 (- strand)
ATGACAAATCCAAACTCGCAAAAAGTTGCTGTTGGTGGGCCAGGTAAGCAGATACAATGCTATAAGGAGTGGCCGGGACT
TGATCGCATTATCCGATAACTCTGACGCCATGTCGACCACACAGACGATGAAGAGCAAAGGCTGTTGGACGTGCAAAGGT
AAGTGGCAAAGGGTGGGTGTCGTCGGCAGTCTGATTCTTACGTTTCTACAGAGCGAAAGGTGCGCTGCGACCGAGGCCTG
CCGGCGTGCCAGACCTGCGTCCGGGCCAAAAAATCGTGCCAAGGATATGGGCTGAGACTGTCGTGGCCACGCGAGAATGA
CAGTAAACGAGCTATTAATTCTTTGGAGCCGTTGTGGACACAGAAACATGTTGGGTCCACTTGGAAGGGCCGGCGTCTGT
TTGTTAACACTACCGGCTGGGATATCGAGCTGTACAGACAGCTTTCCCAGCAGAGTGAGATCCGACCGGCTCTTCTGATG
GATAGTGTGCCACTGCTAAGACAACCTCCTCCTTCGACAGTGCAGAACACTGATCTGCTCGGTTATTGTGAGTATTAAAC
GGCGGCTCCGGTGTGCTATTGGCTGACTAAGCACCAAGTCCACAATGTTGCCTACCTCTCGCTGGTGACTTTCAGCGGCA
CTGCCCAGCAGATCCGGGACATGCTTCTGCGAATGGCCTTGTCTGATGGCGGTGGACACGATATGTCAGGTAGGGCGCTA
CTATATTCGCTGCTAGCTGTGGCATCTGTGCGCCGCAGCGGAGTGCAGCCAGAGGCCATCCGACTCAAGGTGGCTGCGCT
AGAGGCACTGCGCACAGCTGTCCGACAACAGCAGCAGCAGCAACAACAACAGAGGAGAGGAGTAAAACTGGGCTCCGCGG
CACCTATTGTGGCAGCATCGATGCTTTTGTGCTCGTACGAAATCGAGCTTCCGTCAGCCAGTTCGGGCGAGTGGCTGTGG
CATGTGCAAGGGGCCATTGGCCTTGTTCGGGAGACCCAACTGGAGCAACAGCTAGACAGTGATATCGTAGGTGACGATGA
GAATATGCTGGTCGAGTGGGCATACTACCACGCAACTCTGTCTCGCTTCTCGATGCAGCATTGGCGACATGGCAGCCAGG
GAGAGTACTTTTTGCCGGTAAGAGATTGTTTCTATCCGCTTCGTAGTCATTTTCCTGTTTCCAGCTAACAAAAAGACACA
ACCTTGCCGGAAACCGACACTGGCTGTGCTCAACTTCCTCGACGAGGCTTGCGGCACCATCATCGACCCTAGAGATCTGC
GCAGCAACGAGACGGCATATCGGGAGAGGTTGCGGACGCTTCAGCTTCGCGTGCAGAATTTTCCAGCCGCCACGTCGCTG
ATGGCTTTGAGTTCCGTGACGCCTTGGTCTGAGGCTGACCGGACGGTCGTGGCTGTTGAGCTGTTTCGGGTCGCCACGTT
GGTGTATCTCGTGCGAGCAGGGACTTCGTGGGCGTCTCTGTCGGTCCTCCCATCAACATCACCATCACCACCACCACCGC
CCATCGACCTAGACGCTCTAGTAGCCACTATCTATGACATGCCGCTGCAGATGCACCCCAGCTGTGACCACTTCTTCCCG
CTGCTTATCATCGGTGGCGAGGCTCGCTCGGATGAGCAGCGAGCCACCGTCCTCGCCATGGTCGAGCGAACGGAGCGGAT
GACGCAGGCCCGCAGCATGCAGCGACTCAAAGCCGGCCTGCAGGCGGTCTGGGCACAGGTCGACCTGCACGCCGATGGCG
ATCTGGTGCTCAACTACTTCCGTATGATGGACGCTGTCGTCAGTGCCAACAGACCGCTTCCATCGTATGTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62