GenePrediction:GLEAN_827 Details

Name: GLEAN_827
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:270825..272497 (+ strand)
Length: 1673
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:270825..271131 (+ strand)
Length: 307
Type: CDS
Source: GLEAN
Position: GCSC_132:271192..271867 (+ strand)
Length: 676
Type: CDS
Source: GLEAN
Position: GCSC_132:271930..272497 (+ strand)
Length: 568
>GLEAN_827 class=GenePrediction position=GCSC_132:270825..272497 (+ strand)
ATGAGAGGCCTCTTCAGCCATGTGCTTCTGCTGCTCTGCGTGGTGTTCCCGCGCTTTTCTCAGGCTGAGACACCCCAGCT
GTCGAGCTGTGCCGTATGCCTTCCCCGGTTCAGCTTGATGTCCGGTGTGAAGTGCGAGCTCCCGTTTGCTAACTGCAAGT
GTGCACAACAGCTCAGTTGTCTACTACAAGCCATGCCCCAGACACCCTGCACTCTTACCAACAACACTTGCCTCTGCACC
AACACGGAACTGACATCCCTTGTCACCGTCTGCCTTCTTGCCAACTGCACCAATATTGAGTTGCTAAGTACGTGTATTTG
TTGTGCCTCTCCATTTCACAGTGTAATTTTGCTGACATCGCATCTAGCGACAACAAATGTGACTTCGATCAATTGCGATG
CTCCAATTCGGAGGAGGCAGCAGTCGTTGAAGGCTACCGCTATCGCTCTCAGCGTCCTCAGTGGCATTTTTGTCGCGCTT
CGCTGCGGATACAGAGCCTTCATCCTCCATACCAGACTTGAGCCGGACGACTGGTGCATTATGGCCACTTCAATTGTCGC
CATCCCACAGATCGTCCTCGTGATACATGGCACAATCGCCAACGGACTCGGCCGTGACATCTGGACCTTGCCAGTGCACA
AGATCTACAAGTTTGGCAGGTTCCTTTACGCTCTCGAGATGCAATATTTTATCAGTTTGATGATGCTGAAAGTTTCGTTG
CTCCTCTTTTATCTACGCATATTTCCGGACAGGAATGTTCGTCGGATTCTCTGGTCGACAGTGGCCTTTGTTGTTGGCGT
CAGCGTCAGCTTCATTTTCCTTTCTATGTTTCAGTGCCGGCCAATCTCCTATTATTGGACCGCTTGGGACGGCGAGCACA
AGGGCCACTGTATCAACGGTAATGCGATAGCGTGGGCACATGCTGCCTTCAGTATCATCGTGGATTTCTGGATGCTGGCC
ATCCCCCTCTCGCAGCTTCGGCATATCAAGCTGGGCCTGACCAAGAAAGTTGGCGTTGCCATGATGTTTTGCGTGGGGAC
TTTGTATGCCGTACCTTTTGTGGCGCTCCGTTGTTAAAAGACTACTCCTACTGACAGATATGCAGTGTCACCGTTGTCAG
CATCTTGCGCCTGCGCTCCCTAGTCAGCTTTTCAAAGTCCAGTAACCCTACATGGGAGAATTCAGAAGTTTCCAACTGGT
CGACTATCGAAGTTTGCGTCGGAATTATCTGCACATGCATGCCGTCGCTCCGCCTCATTCTAGCTCGTATCTCACCATCT
GTATTTGGCGGCTCATCTGCGCGCACCTATGCGAACTACCCAGAATACGGCCACAACTACGTCGGTCCAAACGTTGAAAG
AGGCCACAGCCGAGTGATCGGCAGTATCGCCTTGGTCTCTACTGGGCGGTCACACAACAAAGATCAAAATACCCTCACAA
CGGATACCATCAACGATCGTTCGGGGTCTGGCACTATTCCCAATAAGTCTAACAGTGCGAATAAGTCGAGCGCCTCAGAA
GACATACATGGGATCACGTATTCGAAATCGTATGCTGTCGAGTATGGCTCCGAGTACAACGACCAAGCACGGCTTGTTGA
CAACAATGCCGCAAGCTCTCACCTAGCTCGCTCAGACACGATCAAGTCAACAGACCACAATGGCGTTAATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62