GenePrediction:GLEAN_8280 Details

Name: GLEAN_8280
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:161756..159311 (- strand)
Length: 2446
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:161756..161695 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_124:161394..161240 (- strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_124:161172..159658 (- strand)
Length: 1515
Type: CDS
Source: GLEAN
Position: GCSC_124:159600..159311 (- strand)
Length: 290
>GLEAN_8280 class=GenePrediction position=GCSC_124:161756..159311 (- strand)
ATGGAGGCTGTGAAGGACAGGCCGGAAGGCAAGGCCGTTAAAGGGAGCAAAACAGTAGCACAGTAAGCAAGAGAGGGTCA
GGGGATCCTGCTTCCCGAACACGTGCTTTGCCGGAAGACAGACCGGGTGCGTCGCCGAAAAGGTCCTTGAAGCTTCTTCT
TTCCCGACGATGGGTGCATTTGTGCCGGTGTTTGCCGCGACGCCATTTGCCGACGCAATGCGACATAACTAGTCGGCGGC
GTTTCCCGATTTGGAATGGGCTAGCAGGGGGTCACCCATATGATCCGGTCTTTCCATATTTGCCGCAGTTTCCCGCACTC
TGTCCTTTGCACAACACAACGGTCTTTTGCAGCACTCGACAGACCTCCCCAGTACGCGCGTCCTGGCCACGACCCGGCAT
CTCTCGGACATCGTGACGGCATTGGTGCCGAACAGCGACACGTTATGGAGCTGCCACGTGATGGCCGGCCGTCCGAGAAC
GGTCGCAACCGTCGGCCAAAGGCCGGCAAGGCGTGCGGTTAGTGGACCGTTGGTGGAAGCGGAGCGGCCGTGAGAGCTGG
CGGGTCTGACGCGTGCCGTTACAGTGAACTGCCGCAAGCAGAAGATGAAGTGCGTGGACAACCAGGACCCACGGGGCTGC
CGGCGATGCGTACGGTCCGGCGTGCCCTGCATCTTTGTGCCACGTGCGAACGCAGCCACCCTACCGTCAGGACTTCTGGC
CCTGGCAGCTGGGCGGCCATCAGTGGACCGGCCGTTCAAAGATGATGTTCTGCGGCGACTACAGGCTCTTGAAGAGTACC
TGGGCTTCTCAACAGCCAATGGGAGGCGACAGTCGGGAGGCTCGGACGACGAGTTGGACGACAACGACGAAGACGGACAG
GCAACCGGGGGCACCGGCTCGGACGACGAGGGGGAGGTGCCAGCAGCGTATGCATCACTGGGTGCGCTGTGGGAGGCGAC
GAGTGTGCTGTGCGAGTCGGCCCCGACGTCGGTGCCGCGACGGATCTGGAAGAAGGCCACCGTGGGCGAGCTTTGGTCGG
CCTTCCACGAACGCATGCCGGGACTGCACTTCATGCCACGCAAGCAGACATTTTCGGTGCCCCAGCCTCTGCTGGTAGCA
TCGATCCTCTACTGCTCGAGCATCCGGGGACCGCCCGACATGGCCGCCGACCTGGCCCCACACTACTTTACTGTGCTTTG
CAACGCCATCGCACAATTGAGCGTTCCGGAGAGCAGCATGGGCCGGCCGTATCCGCGTGGCGGGAGCAGCACAGCCACAA
CGGATGCCTACGAGGAGTGGGCCTTCCAGACAGTGCTCGGCATCGTGCTGGCAGGCCTGCTGGCCGAGGCCAGCGTGACG
GTGACAGGCCTGTGGATCTCGGTGGCTTACCGGCTGATCCTCGAGCACTGTCCAGCCGATCAGGCTCTGCTGGCAGCCAA
CAACGACGGCGGCGGCGGTGCTCGCGAGTGGCGCAAGCTGTTCAGCGGTGTGCAGATTGTCGATCTAGAACACGCATCCC
TGCATCTCAGCTGTCCCGTGATTCCGATCGAGTGTCCTCTCCCAGCGCTCAGTGTCGGTGTCCGTGACCAGCTGTACCGT
CTGAGCCGCATGATGCACACGGGTCTGACACACTTCACCGGCCGCGGACTGCCGACCATCTGGTCCGTGTTCACGGGCAA
TAGCAGTAACGGAAACGGCAGCGGCAATGGCATCATCAGCACAGCAACCCCTGCCTTCACTGCGGTCGACGCGGCCGTCA
TCCGCGACTGGGCCCACCAGCTCGACGGCTGGCTTGTCGAGTTCAGCAGCATGTCTGATGACTCAGCATCGACTGCCCTG
GACCGACAGGTGGTGTTTCGGCAGTATGTGCTGCACCGACTAGTGGTGCTGAGCATCTACCACCCGGCACGCGGCTGCGA
CCTCTGGAGCAACGGCATCACACCCCAGGAGCAGCGCGAGCTGCTATTGAGTGCGCGGGCCACGCTGAAGCTGCACTTGC
ACGACGACAGCATCTGGAGCAATTGGGACCTGGTCATGATCACGTGGGCAGCCCTGATTGTAGTGCAAGGCGTTGAGGGG
GGTGTGGGAGAAGCAGATGGTAAGCAAGCATATGGTCGTCTGCAAGAGGAGATTATATATCAACACTGACTGTTAGATCT
TCGGAACATCCGCGTCCACCTAGAGATGCTCAACCAGATGAACGTGCCCAAGTCGAAGCTCTGCGACCGGCTGATCGGCC
GTTTGGAGGAGAGCCTTCGGGGCGTCAACACACCCGACATGACGGTCTTGGCCATGCAGCCACAGCCACAGCCGTCTTTC
CTAGGACCGGACGACACGACGACAGGGCCCAGCCCCGGCAGCATGGACTACAGCGCATGGCAGATCTTTGACCAGGCCAG
CCTGCAGCAGATCTCCTTCCGGGCAGAATGGGCAGGTCGGCCGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62