GenePrediction:GLEAN_8281 Details

Name: GLEAN_8281
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:150889..148810 (- strand)
Length: 2080
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:150889..150725 (- strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_124:150542..149853 (- strand)
Length: 690
Type: CDS
Source: GLEAN
Position: GCSC_124:149782..148950 (- strand)
Length: 833
Type: CDS
Source: GLEAN
Position: GCSC_124:148897..148810 (- strand)
Length: 88
>GLEAN_8281 class=GenePrediction position=GCSC_124:150889..148810 (- strand)
ATGTGCATTTTCCTTTTTCTACTGCCCCGGTCCACCGATCTGGACAGTTGGTCTGCCGAGTCGATATCGCTGCGCGTAGT
CCCCGATGCCGTCGAGCCTCCGGAAATTGCTGCTGCCACCGGCCACAGACTGCTGCGGTATTTGCCGGGCTGTTGTGGAT
ACCACGTGCGTTTGCAAGCTTGCTGATCCTCGGGATATTTGATCGTCTTGGTTGGACCTCCTCTCTGCAAGGCTTCTCTG
TCTCCATCCATCCTCATCCGACGCATTCCCTGGTCGGTCTACTATCGTCCGTAGTCATGCGTCCGTTTTCTCTTGGGCTT
GTCGCCCTGACGCTCGCTTCCGTCCAGGCAGCAAAGCTCTCGCCCATTGTGCAGGACATGTTCGATGGCGAGATGCGCTT
CCTGGACCGGCTGTATGACAAGACGGCCGGCTATCTGTACAACTTCTACTACCCCTTGGCTGCTGGGCCGCATGAGACTC
GCTCGTCCGTGTGGTTTGCCGTCGGCCTGTTGCAGCGCAACAGCGGCGATGACCGGACCAATGCCGTCAAGATCATCAAC
AACGTCATTGCTGGCCAGGAGAAGAACGTGTCGGCCCAGTGGTATGGCGACTACACCGTCTATCCGGAGCAGCCGACGGT
AGGCAGCAGGAGCTACGATCCCGTGATCTACAACTCTTGGGACCCCAACTGGCGCGGCTTCATCGGCACCGCCCTGATTG
TCATTTATGAGGAGTTCGGCCACCTTATTGGCCGCGACGTTCAAGAGCTCATCGTCGAGTCGCTGTACAACAACTCCATC
GGCGACAGCTACCGCGTCGGCGGCGTCGACGGCGATAATCTGTACCCGTCGTACAGCAACCCGTCTCTGATGCGTGCCGT
GGTCACCGGCTGGAGCGGACGCATGTGCAACGACAGCAACATGACCGCTGCCGGCGAGGCCTATGCGCAGGAGATCATCG
ACCTGTTCAACCTCAACAACACCCTGTCCGAGTTCAATGTGCCGACGTACTACGGCGTCAGTCTGACAGCCTTGACGGTA
AGGGAAAGGGGGTGAAATACGAGGTTTGACACGTGACCTGACAGCTGACAATCGCTATTACCACCAGCTCTGGGCCAAAT
ACCTGCCATCCTCGTCCGTCATGGCCCAGAACGGTCCCCGCATGGTGGCCGACATCTGGACGGCCTTTGGTGACTTCTAC
AACGCCCAGCTGCAGAACCTGGCCGGCCCGTGGGACCGGTCGTACGGTTACGACATGAACAAGTATGTCGCCATCATGTC
GCTGCACATCTGGTCGCTCGTTGGCCGCCAGCACGTCTTCGGTCTCGGCAGCGTGGACACGTCCGAGGACCCCTGGCTGC
TGACCCACGCTGACGATGGCGAATTCGTACCCCTAATCGCCGTCCTGTCCGACTTCCATCGCTCGCTGGTGCCGGCCAGC
GTCATCCAAAGCTTGACCGTCTTTCCGGGCGAGCACACGGTCCATCGGCAGGCCTACACGCCACCCTTTGACCTCGATGT
CCGCAATATCTCCACCTGGCTGTCGGCCGACCTGACCATCGGCGCCGACTCCTATAACCAGACCGTCGTAGGCGGCGCCA
GCCAGGACTCCAACTCCTTCAGCCCGGCCATTGTGCACTGGCACCGCAATGCCACCGCCCAACAGGCCGCCAGCGTTGGA
TACTTCTCGCTGCACCCTTCCCAGTCCAGCATGCAAGCCCGTGTCGGCCCGGGCGCCCTCAACCTGACCTACCCGGCCGG
CAACGCATCCAGCTCCTTCACCTTTGTTGTCGCCAGCAACCCGCTCGGCACCAAGCGCGACGTGACCGGCCTGGCTGACA
TTGACGGCGTGTCTGTCTCGATTCTCAGCGGCAGCACCGTCAACCCGGTCCCGGAGGTCGCTTTCTGCGGTCTTGTTGGC
GGCACTTGCAGCCTCATCCAGTAAGTCTTTTTGGCCGCTCTCCTGCTCTCGCAAACATTGCTGACCAGCCAGCAACTTTG
AGTTCTGGAACCTGACCTTCATCATGCCGGCAAACAGCACTGAGCTGCCGCAGCTGAACCTTCACTTTGACCTCGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62