GenePrediction:GLEAN_8282 Details

Name: GLEAN_8282
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:104250..102089 (- strand)
Length: 2162
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:104250..104007 (- strand)
Length: 244
Type: CDS
Source: GLEAN
Position: GCSC_124:103901..103615 (- strand)
Length: 287
Type: CDS
Source: GLEAN
Position: GCSC_124:103527..103431 (- strand)
Length: 97
Type: CDS
Source: GLEAN
Position: GCSC_124:103371..102089 (- strand)
Length: 1283
>GLEAN_8282 class=GenePrediction position=GCSC_124:104250..102089 (- strand)
ATGCTTCTGTCTGTCTCTCGCGCCCTATGTGCTCTTACCATAGGGCGCGTCGCCTTGGCTGCACCATCTTCGCTCGACGC
CCAGTTGCGCTTCCGGGAGAGCACTAGCCTGGACAGCTGGTTGGAATCCGAGGCTACCATCGCGATCGACCGCATCCTCG
CCAACATTGGCAACAAGGGCCAGTACGCTACCAGTGCAGACAGTGGCATCATTATTGCTAGTCCAAGCACTGACAGTCCC
GACTGTACGTGAAGGCATCACCCAATCTGGCAATTATCATTCTCATTCTCATATCCAGCGGTCTCGTGATGCCATAGTCC
CGTGATGCTCATCGTGCTGACTAAGGAAGATTACTACTCCTGGAGTCGCGATGCCGCGCTCGTGGCCAAGACGCTGGTAG
AGCTGTTCCGCAATGGCGAGACCAGCCTGCAGACGACGTTGGAGAATTATGTCAACGCACAGGCGGTGTTGCAGACGGTC
TCCAATCCATCCGGCTCACTGTCAGACGGCACCGGACTCGGCGAGCCCAAGTTCAACGTCGATGAGACTGCCTTCACCGG
CAGCTGGGGTCGGCCACAGCGCGACGGACCGGCTTTGCGGGCAACAGCCTTGATTGACTTTGGAAACTGGCTCCTGGTGC
GTTGGTTGTGGTACTGCGATTATCTTTTTCGATTTCGAAATGACTTCTACCGTTTACAATATTAACCCGCTGGTTGACCT
CAGGACAACGGCTACTCCTCATATGCAATCAACAACATCTGGCCAATTGTTCGCAACGATCTGTCCTATGTAGCTGAATA
CTGGAACAATACAGGCTACGGTGAGCATCTATCCTCAGGCTGCAGTATGTGACACCCGTGTCTAATGCTTTCATCTCAGA
CCTCTGGGAAGAAGTCAGCGGTTCCTCTTTCTTCACTGTCTCAGCACAGCACCGGGCTCTGGTGGAGGGCAGCTCATTTG
CGGCTCGCGTCGAATCGTCATGCACATACTGCGACTCGCAGGCACCGCAGATCCTCTGCTATCTGCAGAGCTTCTGGACG
GGCAGCTACGTCAACGCCAACTTTGGGTACAGCCGGTCAGGCAAGGACGCCAACACACTGATCAGCAGCATCCATACGTT
TGATCCGAGGGCGGGATGTGACGACAGTACGCTTCAGCCGTGTTCAGCACGGGCGCTAGCGAACCACAAGGTCTATGTGG
ACGCATTCCGGAGCATCTACAGTATCAACAGCGGCTTGGCTACGGGTAAAGCAGTCGCAACAGGCCGCTACCCGGAGGAT
TCATACTACAACGGTAATCCTTGGTTCCTGACCACGTTGGCCGCCGCGGAGCAGCTGTACGACGCTATCATCCAGTGGAA
TGCGACAGGTTCGCTGACCATCACGTCCACGTCGTTGTCCTTCTTCACGGACCTGTACAGTTCAGCCGCTGTCGGAACAT
ACTCGTCCTCGAGCTCGACCTATAGCGCCATTGTTTCAGCCGTCCGTACGTATGCCGACAGCTTCGTCAGCATCGTCCAG
ACTCACGCCATGACCAACGGCTCCCTCTCGGAGCAGTTCGACAAGTCTTCCGGAACATCGCTGTCTGCCCGCGACCTCAC
CTGGTCCTATGCTGCCCTGCTGACGACCAATATGCGCCGTAATGCAGTTGTACCAAAGCCCTGGGGCGAGACGACCGCAT
CCAGCGTGCCGGCCGTCTGCTCGGCCACCTCAGCCATCGGCACCTACAGCACCGCACCCACGGCCTCGTGGCCGAGTTCC
CTGACGAGCGGAACGGCTTCAGCGACGGCGACGAAACCATCCAACACTGCCACCACGAGCATCTCCTCCAGTACCTGTAG
CACCCCGACAGCAGTTGCCGTCACATTTGATGAAATTGCCACGACGTCATATGGCGAAAATGTGTTCCTCACAGGCTCAA
TTGCAAAGCTTGGAAGTTGGAACACCAGCAGTGCCATTGCCCTCAGTGCTTCCGACTACACATCCTCCAACAATTTCTGG
TTCGTCACCGTTAGTCTCCCGGCTGGCACTACCTTTGAGTACAAGTTCATCCGCGTTGAATCTGGTGGTTCCATCGTTTG
GGAGAGCGATCCCAATCGCTCCTACTCCGTACCCTCTGGCTGTGGGATCTCTACGACCTCGGTGAGTACGACGTGGCGGT
AA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62