GenePrediction:GLEAN_8283 Details

Name: GLEAN_8283
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:67406..65060 (- strand)
Length: 2347
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:67406..65510 (- strand)
Length: 1897
Type: CDS
Source: GLEAN
Position: GCSC_124:65376..65060 (- strand)
Length: 317
>GLEAN_8283 class=GenePrediction position=GCSC_124:67406..65060 (- strand)
ATGCCAGAACTAGGTGGCGGAAGGCAGTACAAGTCCAGACGGAACCGGCCCTGTGATCTCTGTAGGTCGCGCAAGGCAGC
CTGTGTCATCACGACACGCCCCCCTTGCGATCTGTGCCGGACTAAAGGACTGCAATGCACCTTTGTCAAGGGGCCCGGCG
CCCGTCGTCGATTGCTAAGCGATTGCCCGTCGGCGGTCTCTGCGACCGACACCAATGACACCATCGTTGCCGCAACCACA
GACGACAACGTCTCTGTGGAGCCCGTCATCTTCCACCGATCCCAGCTCATGGGCAGTCCAGATGGCAAGGGAGAACCTGA
TGGCGAGGGCGAGGACGAAGACCTGAACCTGAGCGTGGACGTGGACACGACCGCTGACCCGCTGCTCGACAATGAGCTGA
CCAGTCGGCAGGCCGTCTCGCCAAAGGTATTGAAAGGTTCAGACCGGTCGCCATCTGTTGCACTGTCACATGGCAATGCC
GTCAATCAGACCGTTGACAGCAGCTGCAGCCGCGTCAGCCTCGAAAACAGTGCCGGCCGGCCTTGCCGCTTTGTCGGCCT
GGCCGGTGAGCTGGACGCGTATCTGATCGCTCGGAGACGGTGCAACGAGTCTCTGCAATCGCAGTCGCCCTTCACGGGCG
TCACGTACCAGTACATGAAGTCGTTGGAGACGGGCCTAGCTGAGTTCCAGCCACCGCCTGTATTCACAGTCGGCGATGTG
GCACAGCTTGAACACTCCAGGCTCGATTCGGAGCTTGACAGTCTCCGTCATCTGCGCCATTGCTTTGGCGGCCTCGTGCC
AAACAGCCTGGCGCGCGAGCTGATGCGAATCTTCTTCCGTTTCATCAGCACATCGTTTCCCGTGCTGAGCCGGCGGCAGA
TGCCGGCGACCGATGGCGCCGTCGATGAGCTGCCGCTGTCGCTGCTGGCGGCCGTCTGTGCGTCGGCGCTTCCATTCGTC
ATATACGATGATGTCTTGTGCGTCCTGGGCGAAGCGGTGCCGGATGCTAGCGAGATCCACCGGATAGCCTGTGACGCCCT
GCACTTGGAACGCCACCACGACGCACGTCTAGCCACAGTGCAGGCCACGCTGTTGGTGCTGCAACGGCCACCACGCGACG
ACCTGTTTGGCGATGCCGCGGCACATTGGCGCATGTGCGCCGTGCTGGTGGCCGACTGCCAGGCCCTGGGCCTGCATCGT
AATGCTGCTGCTGGCTGGGCTGCCCTAGCACGGTGGGAGGTCCGCCTGCGAACACGTCTGTGGTGGGCGGCCGTTGTGAC
CGAGACCTGGACTGCTTTTGGCCAGGGAATGCGCAGTCATATCAACGACGATGATGCGGATGTGCCGCTGCCGACAGAAG
CAGACGTCTACGACCACACAAGCTTAGAGGACGACGATGGTGCTCCGTTTTGCCACCTCGTCCGCCTGACCCTCATACTG
CGAGACATCCACACCGCCTTCTATACTGTGCAATCGGCCCAGCGAACATGCTGCGACTTGCAGACGTCGCTAGATACGTC
CAAGCACCTGTTTGCACGGCTGAAACAATGGCATCAGGCACTTCCTGCGCCACTGAAACTGATGCAGACGGGGGGGCAGC
AAGGCCAGACTGACGAGACGACACGCATTGCCGTGGCCGCGGCTGACATTGGCGCCTTGAGCACGAGCGGCACGCTGCGT
CTGGCCTACGTTGTGGCACAACTGGCGCTGTTCCGTGCGCTGCTGCGGCCCCTGGCCATGGCGGACATGACAGCGCAGCA
CGATGCCGTTCCGGCGGGTTTTTGGGACACCGATGGTGCTGTTGCCATCATGAAGGGTGCTCTGGTGTCAGCTCGGGAGT
TGGTGCGCTTCATCGAGGGCCTGACAACGGCCGATTGGGACGGCTTCTGGCACAGCTGTGAGTTTTCTGTTGACTTTTCA
CGCCGAATTATTTGCTGACATGCCAGGGTCCAAACATAATTTTGCAGTCGCTTCTACGTTCCTCATGCATCTGCTAGTGC
TTACTAATCCATCCACCAGCAGTCCCTTAGGTAGCTCGCCGGACGACTCGACCGAGCTGCGTCTCCGGCCACACGCGAAC
AGTGTCAGTAGCGTCGGAAGCTCACAGGCGCCCAACAGCAGCACGAGCCCTGACGTCGAGGACAGCGCCCCCTCTGGCCA
CTACCTTGATGCGATGCACACAGAACTAGAGGTGCTGACTAAACGGTGGAGGTGGGCGCTGCGATTGGCCCAGAGGGGCG
CCGGCGGTCGCAAGGGACTGATGCGTGTGAGTCTGCGTCGGACAGAAGCGCTATTCCGTGAGTGGCAGATCGGGAAGTCG
AGCAGAGAGGACGGGAAAATAGTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62