GenePrediction:GLEAN_8285 Details

Name: GLEAN_8285
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:48589..46895 (- strand)
Length: 1695
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:48589..47303 (- strand)
Length: 1287
Type: CDS
Source: GLEAN
Position: GCSC_124:47239..46895 (- strand)
Length: 345
>GLEAN_8285 class=GenePrediction position=GCSC_124:48589..46895 (- strand)
ATGGCCACTCAAACAGTGACATCACGGGCCGGTATAACCCCCGCCTTGCCGGAGAACAGCAGCGGCACCACCACACCCAG
AGTCGAAAAGATGCAGCCCGGCCTCGTCGACGGTCCTGTCCATGCTGTCAATGTTCGCACCATCGTCATGGGAATAATTG
TTTCCACAACTGGATTCATGTTCGGCTACGAGGGTGGGTCTATCGGCGGCTACGTCGAGATGATGAACTTCCGCGAGCAC
TTCGGTGATACCATCAACTCCTCCGGCGAAATCACTCTAGGCAAGGTCCGCACCGGCTGCATGGTCGCCTTTCTTTGCAT
TGGCTGTCTGCTTGGTTCCCTGATCAGCGCCCCGTTCGCCGACCGCTTCGGCCGAAAGTACTGCATTGCCGCCTGGAGCA
CCCTCCATATTGTCGGCAATATTGTCCAGATATCCGCCTCCAAGCATTGGTACCAGGTCCCCATCGGCCGCCTCGTGGCC
GGCCTCGCTGTCGGAGCTTGCTCTGTGCTCGCACCCATGTACCAGAGCGAGACTGCACCTCGCCAGGTCCGCTCTGTCCT
GGTTAGTGCCTACCAGCTATTCATCACGCTCGGCATCTTTACGGCCTACTGCATCAACTACGGCACCGAGACCAGAAATG
ACACCGGCTCATGGCGCATCACCATGGGCTGCGGCTTTATCTCGCCCGTGGTTATCGGTGTTGGCATGCTCTTTATGCGC
GAGTCGCCGCGCTGGGACTTTAGCCACGGCCACCCTGAAGCTGCTGCCCTTACCCTCTCGCTCGTTTCCAAGGTGCCTAT
CGAGCATGTTGAGATTCAGCATGAGCTAGCCGAGATGCGCGAAAAGCTCGCCGAGGAGGCAAACCAAGGTGAAACGAAGT
GGCACGAGATTTTCACCGGCCCCGCCATGGCCCGGCGTACGATTGTTGGTGTCCTTATTCAGGCGCTTCAGCAACTCACC
GGTGCAAACTTTTTCTTTTACTACGGTACCCAGATCTTTAGCTCCGTCGGCATCTCCAACTCATACGTAACCTCTATGAT
CCTGGGCGGCGTCAACTTTGGTTCCACTATTGTGGGTCTCTGGGTTAGTCAACGCTTTGGTCGTCGTCTCTGCCTTATAG
TCGGCGGCGTCTGGATGGGCATATGCTTCCTTGTCTTCGCTTCTCTCGGCTCCTTCTCTCTCTACCCCGACTCGAACTTC
AGCGACCCGAACGCGGTCACCAGCCGCGGCACTGGTGGCGCTATGATTGCCTTTGCCTGCCTCTTTATCTTCGGCTTTGC
TACCACTGTACGTATCTCCAACTCTCTGCTATTGCACAGTTCGCTCGTTGTCCACTAACATTTTCTCTAGTGGGGCTGTC
TTTGCTGGGCCATTGCTGGTGAGATGTACCCATCGCGTCACCGTGCCCGCTGCATGGCTCTTTGCATGGCCAGCAATTGG
CTGTGGAACTTTTTGATCTCCTTCTTTACCCCATTTATCACGGCCGCGATCAACTACCGCTACGGCTATGTCTTTGCCGG
GTGCTGCTTTGCGGGCGCCTTGTTGGTCTTCTTCTTCATCATCGAGTCGCACAACCGCAGCCTTGAGGAGGTTGATACTA
TGTATGTCAGGGGCGTTGTCCCATGGAAGAGTGCCAGCTGGACCCCCGACGACGAAGGTCCGGAGAACGGCGAGAACGGT
GAGAAGGCTTCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62