GenePrediction:GLEAN_8286 Details

Name: GLEAN_8286
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:36309..35115 (- strand)
Length: 1195
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:36309..36212 (- strand)
Length: 98
Type: CDS
Source: GLEAN
Position: GCSC_124:36156..35780 (- strand)
Length: 377
Type: CDS
Source: GLEAN
Position: GCSC_124:35725..35115 (- strand)
Length: 611
>GLEAN_8286 class=GenePrediction position=GCSC_124:36309..35115 (- strand)
ATGAGTCTATTTTTGGGCCTCACTTCTCTTTTGGTGGCATTTGCTAGCGAAGCTAAGGCGGATGATGCGACGTACAATGT
AAACGCCATCTGTACCTGGTAGGATGGCCGACTATTTGTGCACTACCGAACTCATGCTGATGTATGTTCACAGTGACCAA
ATGATGCGCTACTATGGGACCTCGCATACGGGGCTCTGGGGTGGGTCATGGTGGGAGTCTGCTATTTTGATGGCATCTCT
CGCCGACATTTCATCGCTCGACTCGACCTACAATGGGACATACTTTGGCACGTATGCAACGACTTACGCCAATGCACCCA
GCTTCAATGGCTATACCGGTTTCATCGACGACTACTACGATGATGAAGGCTGGTGGGCCAATGCATGGATCTCCGTGTAC
GATTTAACTAAGAACCCGAGCTACTTAGATCTGGCTGTGAGTCTTTACAACGACATTTCTGGCGGAGAGTCAACATGTGG
AGGTATATACTGGGAAAAAGGCCACTCGTACGTTGCTGCTATCGCAAATGGTAAGCAACCTAGCACATGATCCATAAGCA
ACGACGACTAAGATATTATGGCAGAGCTCTATATCAATCTTGCCGCTAGCTTGGCAAACCGAGCTCCCGAAGATGCTCGT
CAGGGCTATCTGGAAGAGGCGATGACCAAATGGGATTGGGTTTTCAACTCTGGCCTCGTCGGCTCCGACTGGCTCATCAT
TGATGGCGTCGATGGCGACTCCTGCGTAGCCGAAGGGAACAAATATTCCTACAACCAGGGTGTTATTCTCGGCGCCGCAG
TTGAGCTGTACAAAGCAACGGGAAACGCAACGTACCTTGAGCTTGCAGGAAACGTTGCTGATGCTGTCACGGCGGCTGGC
TCTGCATTCACCAATCATAATGGAGTCATCACAGACTGCGACGGTGGCTGCGACGATCAGGGAGATATGTTTAAAGGACC
CCTCTTCCGTGGATTGAGACAATTGCAGCTTGCCGACCCCCATAGTAACTGGGAGACTTGGATCACGACAAATGCCCAAT
CGCTTTGGAACAATGCCCTAAATGTCACAGTTGTTGACGGGGCATCCGAATGCAACACCGGGGCCGATTTTAGTGGCCCA
ATGACATCAGTGAATGAAATTACACAGGGAGCCGCTTTGGATTGTCTTGTTGCTGCCTGGGCTGTTACGGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62