GenePrediction:GLEAN_8287 Details

Name: GLEAN_8287
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_124:31457..28810 (- strand)
Length: 2648
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_124:31457..31144 (- strand)
Length: 314
Type: CDS
Source: GLEAN
Position: GCSC_124:31075..29505 (- strand)
Length: 1571
Type: CDS
Source: GLEAN
Position: GCSC_124:29451..29362 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_124:29291..28810 (- strand)
Length: 482
>GLEAN_8287 class=GenePrediction position=GCSC_124:31457..28810 (- strand)
ATGCCGCTTACTTTCCGCTCTAAGAGAACAGCCGACCCCGGCGAAAGCATCGGCGTGGATGCGGGCAGAAACCAAATCCT
CCCCGACAATGGGAATGGGAATGGGAATGAAAAGATCATCATGGCCCCACCTGCAGAGGAGTTGACAGACGCGGAGGCTG
CTCGGCGGCTCAAGCTCTTCCGCCAGCAGGCCTTGGTCGACCCGAACATTCCGCTCGAAGACATCGATGCCATCGACCAA
GCCGTCGACAGCCATGACGTCAAGATGGAAAATGACCTTGTCCTGGAAGTCGTCGATGACTCACCCTACCCTGAGTGCGC
CCTTCCTTCTTCCCCCTCCTCCCCCGTCCATAGTAAAACAGTCTGGCTAACACGGTGGCAAGAGTGCGTTCTGCGGTGCA
CAATTATGACGAGGATCTGCCGGCTAATACGATCCGTGCCTGGACCATCGGCATGATTATGACAACCATTTTCTCAGGTC
TTAACTGTCTCTTCTCTCTCCGGTCGCCCTCTATAACCATCACGTCCATTGTGGCTCAGTTGATCGCCTACCCTATCGGC
ATGTTCTGGACATACATCTTCCCAGACCGTGTGTTCAAGATAGGCCGTGTAGAGTTCAACTTGAGCCCGGGGCCATTCAA
CTATAAAGAGCACGGCCTTATCGTCCTTATGTCCAACGCAGCCTATGGTGGCGGGGCCGGGTACTTTACCGACATCTTGA
CGGCGCAAGTAGGCTTCTACAAGTTTGACTTTGGCTGGGGCTACGCTATCTGCTTGGCCCTGTCGACGCAGTGCATCGGC
TTCGGCCTTGCAGGCATCGCGCGCAAGTTCCTCGTCGAGCCGGCGTCTATGATCTGGCCGGCCAACCTGGTCAACACCGT
CTTCATGTACACGCTGCATGACCACTCCAAGACGGACCCGGCCAAGGCCAACGGCTGGAAAATCAGCCGCTACCACTACT
TTTTTTACGTCTTCCTCGGCTCCTTTTGCTGGTACTGGATCCCGGGCTTTCTCTTCCAAGCCCTCAGCGCCTTCGTTTTC
CCAACCTTTATCGCGCCCCACAACGTGACCGTGAATCAGGTCTTTGGCGGTTGGACGGGCATGGGCCTGCTGCCTATTAC
GTTTGACTGGACCCAAATTAGCGGCTACAACTTCTCGCCGCTGATTGCGCCCTGGCACGCGCTTATGAACACGCTGATCG
GTGTTGTTTTCTTTTTCTGGATCGTCGCCGCCGGCATCCATTGGACTGGTACCTGGTACGCCGACTGGCTGCCATTCAGC
GACTCCGGCAGCTGGGACAACACACAGCATTCATACAACGTGAGCCGTATCATAACGGCGGACCATCGCCTCGACCTTAC
AGCCTACAAGGAATACTCGCCCCTTTTCCTCTCTACCACATTTGCCTTGTGCTACGGCCTGTCCTTTGCTGGCATCGCTT
CCGTCGTTGTGCACACCGCCCTCTTCCACTCCCGTGAAATCTGGCAGCGTTGGCGCGACCGCAGCGGCACGCTTGACGAT
GTGCATGCTAAGATGATGCGCAAGTATAACCCTGTGCCGGACTGGTGGTTTCTTTGCATCTTTTTGCCGTGCTTCGCGCT
ATGCTTTGTCTCTGCGTACGTCTGGGATACCGGCCTAACTTGGTGGGCTATTATCATTGCCATTATCATATCATCTGTGT
GGATGATTCCCGTCGGCATGGTCCAGGCCGTTACCAACGTCCAGATTGGCCTCAACGTCTTCACCGAGTTCATCGTTGGT
TACATGCTCCCCGGCAGGCCTAATGCCATGATGATGTTCAAGACCTACGGCTACATTACCATGACTCAGGGTCTTATGTT
CGTGCAGGACATGAAGCTCGGTCATTACCTTAAGCTACCGCCTCGCACCATGTTCTTTGGCCAGCTTATTGCCACTGTCT
GGGCTTGCCTTGTACAGATCGCCGTTTTTTACTGTAAGGATTTTTGTCTGTCAATGGTATATGTATCATCGGCTAACTTG
CCCCAGGGGCCATGGGAGCCTTAGATGGCATCTGCACCAGCGAAGCCGTTAGCCGCTTTACCTGCCCCGGTGGCAAGGTT
TTCTTCACAGCTTCTAGTAAGTCGGGTTATGCTAATATTCATTACAATACTATCCGAAGTTCCATTTGCTAACGGACTTT
GCGCAGTTATCTGGGGACTTATTGGTCCACAGCGTATCTTCAGCGGCACTGGCATCTACAAAAACCTGCAATACTTCTGG
ATCGCCGGTGTTGTGCTGCCCATCATCTTCTGGGCTTTCCAGCGCCGTTACCCTAAATCCTTTGTCCGCTATCTAAGCGC
CCCTATCATCTTCTCCGGCAACGGCCAGATCCCTCCTGCGACGCCGCTGAACTATTTGGCCTGGGGCTCGATCGGACTGT
TCTTCAACTACGGCATCCGCAACAAGTTCCGCGGCTGGTGGATGCGTTTCAACTACATCACGTCTGCGGGTCTCGACACA
GGCCTTGTTATTTGCACCATACTTATTGTGCTGACTATTAGCTTGACTAGCACGTCGGCACCTAAGTGGTGGGGCAACGT
TGGCGCCCTTAACACGATGGATTATAACGACGAAGCCTGGTATAATAACGTGGCTGATGGCGAGAAATTTGGTCCTAAAA
ATTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62