GenePrediction:GLEAN_8288 Details

Name: GLEAN_8288
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:1881206..1881918 (+ strand)
Length: 713
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:1881206..1881467 (+ strand)
Length: 262
Type: CDS
Source: GLEAN
Position: GCSC_113:1881608..1881918 (+ strand)
Length: 311
>GLEAN_8288 class=GenePrediction position=GCSC_113:1881206..1881918 (+ strand)
ATGGGCGAAGATTCAAGGGGCGTAACATGGGAGGCCGACAAGGAGAGGATTCTCAGGACAGCCGTGCCGTACTTCGAGGC
CGGCAAAGAAATTGTTGTCGTCGCTCATTCCTATGGCGGCATTCCGTCAACTGTAGCTGTTCAGAACCAGGAAGTCGCCG
AACGTTCTGCAAGGGGCCTTAAAGGAGGCTTCCGAAATATCATCTTTCTTGCTGCCTTTAGCATTCCTGTTCGTGGGTGG
GATCTTATCACCACCTTTGGTGGTAAATATCCTGAGTGGATGACAACCTCTGAACTCTACATCAAGGCAAGCTACTCTAC
GTCCCATTCTCTGAATTTCACGAATAGTTATATGCTTACATGATGCTTGCGGTATAGAATCAGCTTACTACAATCAACGA
AGAGGGTGGCCGCCAGGCTCTTTACGATGACGCCACGGAAGAGGAGTCCAAGAGAGCGTTCAAGCTGATAACAACGCATT
CGCAAGACGCCTTTGAGACAGAGGTCGATTTCATTCCCAGTGACATTACGATCCCCAAGTCGTACATCATCTGCGAGAAC
GACCGAGTTATCCCTGTGGCTGTGCAAGAACAGATGATCAATGGTACGCCCGGAATGAAGGCACACCGATTGTCGGCAGG
CCACAGCCCATTTTTGGGCAGGTTGAAGAATACTGTAGACATAGTGGTCAGCGTTATCAATACTGACGCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62