GenePrediction:GLEAN_8289 Details

Name: GLEAN_8289
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2020794..2020462 (- strand)
Length: 333
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2020794..2020681 (- strand)
Length: 114
Type: CDS
Source: GLEAN
Position: GCSC_97:2020641..2020462 (- strand)
Length: 180
>GLEAN_8289 class=GenePrediction position=GCSC_97:2020794..2020462 (- strand)
ATGCCTATCAGACTGGCCAGGATTTACTTCAGGCGGCTGACCATCTGGAGCAGTCTTTTGTTGTTGACCACGGGCTACTT
CCTATTCTCAGACGTGTTGCCCGACGTGGCCAATGTGTATCCATATGCCACAACTACCCCGACATCCGATTAGCATGCCC
TACGCAAGCCCCTTCGCTCGCAGTGGCATCCTATCGACCGCTTAATCGATGAGGTCAACATGACCTTTCACCGCCTCCTG
CAGTCACGCTCAACAAACTTGAGCGATGCAGCAGCGCGCTACCGCGAGCGGCGGGGCCGTCACCCGCCGCCTGGTTTCGG
CGCGTGGTGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62