GenePrediction:GLEAN_8290 Details

Name: GLEAN_8290
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2142292..2140936 (- strand)
Length: 1357
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2142292..2142208 (- strand)
Length: 85
Type: CDS
Source: GLEAN
Position: GCSC_97:2142144..2142076 (- strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_97:2142018..2141434 (- strand)
Length: 585
Type: CDS
Source: GLEAN
Position: GCSC_97:2141372..2140936 (- strand)
Length: 437
>GLEAN_8290 class=GenePrediction position=GCSC_97:2142292..2140936 (- strand)
ATGTTCGAGGGGAAGTACACCACCATGGGCAGTCGTTCCACACTTCACCCACGAGTTGTCCGAGGTCAATTGAACCGAAA
CTTGTGTAAGACTAAAGAGAATTGTTCCTTTTCATATAATTAGTTCGCGATGCTAACGGTTACGCCAGGGACTGTCATGG
AACACATTCAAGAGGAGATCAAAGACGCCTTTGAAGATTCATTCCCCCCCTGCGATGGTATGAAGCAATCGTCATATTTA
CTCATCCGTCCACACACTAACAATGCTCTTACAGACTGGACCGAAGTGGACGTGGTAGACCGCATCACCCAAATTGTGGC
CCGCGTCTCAAGTCGCATGTTTGGCGGCACAACTCTCAGTCATAACAAGGAGTGGATCCAATCATCTATTGACTTTGCAA
CGGATGGTTTCATCGGAGCCCAGGCCCTGAAGAGTTACCCCGAGTTTATGAAGCGCTTTGTTGCTCCTTGGATACCAGCT
ATTCGGAACATCAAGAACCACTATGCAGCCGCAGAGAAAGCCGCCATTCCTCTTCTGCGTGAGCGCCAGGCGTCGGGCAC
AGTAGCCCCAGATCTGCTGTACTGGATGGCCGAGGATGCCAAGGGCGACGAGAAAGATCCAACTTTCTTGGCAGGAATTC
TTCTTAAAGTCAGCTTTGCGGCTATTCACACAAGCGCCGCAGCTCCGACACAACTTCTTTACGATCTCTGCGATATGCCG
GAGTACATCGAGCCACTTCGGCGGGAGATTGAGGAAAATGTAGATACTAACGGCCTTCTTAGCCGACAAGGCTTCCAAGG
CCTGACAAAACTGGACAGCATCATGAAGGAGAGCCAGAGATTCAATCCCCTACTGTTGGGTACGTTTCATTTTGAAGGTC
CCTCAACCAACCGCAGTGCATACATGCTGACAATTAACAGTCACATTTGAGAGAGTCATCGCCAACGATTACACTCTGTC
GGACGGTTTGAAGATCCCTGCTCACACCACTATTGGCATTCCAGCTCATGCAATCTCGATGGATCCTGAAATGTTTCCCG
AGCCAGACCGTTTCAACGGTTTCCGGTTCGATGAGATAACAGCCAAAGAGGCAGCCCAGACCGAGAAAGGCAACAAGGCG
GAGCCGTCCGTTACATACGCCGCCGCTCACCCGTCTAGCATGGCCTTTGGCTACGGTCGACACGCATGCCCAGGTCGCTT
TTTCGCCTCGGCTGAGATCAAGGCTATCATGGTTTATCTCCTGACACATTACGATTTTAGGTTCCCTGATGGGCAGACTG
AGCGCCCGCCCAGCCTGATTTTTGAGACACAGAATTTGCCTAACCCTACAGGGCGTATCATGTTCAAGCGGAGGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62