GenePrediction:GLEAN_8291 Details

Name: GLEAN_8291
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:407943..407594 (- strand)
Length: 350
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:407943..407770 (- strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_108:407737..407594 (- strand)
Length: 144
>GLEAN_8291 class=GenePrediction position=GCSC_108:407943..407594 (- strand)
ATGCGCGAGATCAGCGACAAGAAGGATCACGACGATCAATCTGGCCGTACGAAGACCTCCGACGGGACCGCTTCCCAAAT
ACTTCGTAAAACTTTGTATTGGGTTGGGCGATCCCTGAACTGCCGACTGGTCTCGGGCTGGCAAGAGCCTCTCATGATCG
GCCGCTCTCTGCGCGTACGAAGTATGCATATCTCTTCCAGGAACAGATACTGTACATAGCGCCGAGAAAGATGCATTTCC
GCATCTCCGGCCACGAGCGTCCTCGTTGTGGAGACACTACCGTTCACCGGCCGCCGGATGCATGCACCGGACCATCATTA
TCTGCTCCGTCCGAGTACGAGAATGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62