GenePrediction:GLEAN_8292 Details

Name: GLEAN_8292
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1989174..1985471 (- strand)
Length: 3704
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1989174..1987297 (- strand)
Length: 1878
Type: CDS
Source: GLEAN
Position: GCSC_173:1987225..1985471 (- strand)
Length: 1755
>GLEAN_8292 class=GenePrediction position=GCSC_173:1989174..1985471 (- strand)
ATGGACGATCGCCGCCAGAGCCTCAAACCGTCCGGCCTGCCACGGCCGTCTCGACTGCCCGTTGCCTCCACCCCATCATC
CATTTCGACCTCCCACTCAGCGCCCTCGTTTTCCGCAACCACGAACAGAGCCTTGCCTCTGCGGCATACCCCATCCAGAG
GATCTCTGTCAGGAGACGCCCTCGGTGGCCAGCTGCGCAACCCGAAGCTCCGAGCCGTTCCGTCGCGAGACCGCCTCAGC
CCACAGCTATCCTCAGGCTCGCCTGCCAACTCGGGTCTCCAACACCCATCTCCCCGTACCCGTGCCGTGTCTGGACAGTA
TGTCAAGGGGGCGAGAACACCGCCGGGCCCCAGCGCGCCGAACTCGCGGCCGACCACGGGTGACACAGCCAAAAAGCTGT
TACCAAGACCGCTTACTCGACGTGCCTCCTCACAGCAACTGGCGAACACCCCTTCACCACCGACATCACACTCCGTAAGC
CCCGTGGACGACTTGTTTCTCGATACCGTCAGCGAACAGAGTGTAGGCGATGCAGGAGACTCGCTGCATCCTCGACGGCT
GCGTCCACGTCCATCCCTGACCGAAAGAACGATGGAGACGCTGTCCCAGATCCCCAACTCGCCCGCCGTCAAGGGGAAGA
GCTTTGGCTTTTACGACGATGCCGGACGTCTGGCACAACGCCGCCGCGGCAGCTCAGCCGGGAGTACCTCTCGGCCGGGC
TCTAGCTTTCAGTCCGATGGGTCTTCTTCCCGCCCACAAAGCCGGCCAGGTTCGAGTTTGCGGCAGGATGACACCAGCAC
CCCGAATCCCTACACCGCGGTCAACGCGTTCCGATCTGCCACCTCGTCCTTTGTTCCTATTGATGAACTGTCGAACCCAA
GTCGCATCGCCAGCCCACGCACCCTGAGAGCACCGCCTTCCCGAACCTCGCTGAACGCGGCCTTCCGGGCGGCGCCGAGA
AAACAGACGGACCTCACGTCACCACCCAGTGACTTCCGCGCGATCAGCCCAGAAAAGTCGCCTGTTGCTTCGCCTGTGCC
GGGGAGGTTTGGTTCTAAGACGATCGCAGCTCGACCTCTTATATCCCGCCCGTCCATCAGCCGTCTGTACAGGAAACCGT
CCATGTCCAGCCTAGAGTCATCGGTGGCTTCGCCTGCCCCTGTGAAGAAGAGCGTAATTCCACCTCGCGCCTCGTCCACG
TCCCGCGAAGGAGCCAAGCCGTCTAGGTCCCGCGACTCAGACTCAGCAGACTCAGCACAGGCTGCAGCCGACAACAGTCG
GAAGTCATCTGCGGCTCTGCGGGAGCAGATTGCAAAAGCCAAGGCAGCGAGGCGGGCTGCGGCACAGCCGGTGATAGAGG
AGAGCCCGGTATCGACTGCTGCGTCCGATCCAACAGCAACAACCGTATCTACATCGGCGACCAGCTTGAGCGAGGCCGGC
GAGGCGCCGGTGATTCCGACAGACAGCACGTTCGACTTTGGCCTGAGCACAGATCCTTTCGGTCAGGGCCGGACCAAACA
AGCACACACAAAGGTCATACAAGCCCGTGTTGATGCGGCCCGCACGAGCGGCCGGCTGAATATTGCGGCCATGGGTCTGC
GAGAGATTCCGAAGGAGGTCATGGACATGTACAAGTCGAATTCGGGCGGCTCGTGGGCGGAGAACGTGGATTTGACACGG
TTTGTGGCGGCGGACAATGAGATCGAAATGATCGAGGACTCGGTGTTCCCCGACGTCGATGTACAGGAGCTGGCCGACAA
CGAGGAGGGCTATTTCAATATCTTTGGTGGGCTCGAGACTCTGGATCTGCACGGCAACATGCTGATCTGTCTGCCCATGG
GACTGCGGAGGCTGCAGATGTTGACGTCTTTAAACTTGGTAAGCAGCGAAGGAGCGTCGTTAACTTTAATGGGCGAAGAC
ACGAAGCTAACATACGGTGACAACTTTAGTCCCAAAACCGGATCACAAACAATGCATTCGAAGTGATCTCGCAGATCACG
TCACTACGCGACCTGAAACTTGGTGGAAACCTGTTCTACGGGCCGTTGGACCCCTGTTTTGCGAAACTGGAGAACCTGGA
GAGTGCAGACCTGCACGGCAACAACATCTCTGTGCTTCCGGTGACTGTCGGCAACATGGCCAAGCTCCGGATCCTCAACA
TTAGCGAGAACAACTTCGAGAGCCTGGTGTTCGAGCCGCTGTCGAAGCTGCCGCTTACCGAGCTGATTGTGCGGAAGAAC
AAGCTGAGCGGGGTACTGATCGAAGACGCGGTCTCGAGCTTGCCACATCTCCAGGTGCTAGATGTGTCGTCTAATCAGAT
TACGCACATTGTGTCAGGGTCCCGGACAGACAGTCTGGAGATGCCAAAGCTGCACAATCTCTGCGTCTCGATGAACCGGC
TGCAGGTATTACCAGATGTCAGCAAGTGGAGCAGCCTGGTGACTTTGGCGGCCGACGAGAACAACATCAGCAGCGTGCCG
AGCGGCTTCGAGACGCTCCCCAGCCTGCGCCATGCCGACTTCTCCAGCAACGACATCCGGGTGATCCCGTCAGAGATTGG
ACGTATGGAGAGCCTGGCGCAGCTGCGTCTCGGCGGCAATCCGCTGCGGGACAAGAAGTTTTGCACAGCGACAACAGACG
AGATCAAGAGCGTGCTGGCCGGCCGTCTCGAGCCGGAACCAGAAGCAGATGGAAAACAGATGGCCGGCAAGGGACTGGAT
CTGACCGCGGATGAGCTGCAGGACGAGCTTCGAGACGCGGTGACGGAGCTGTCCGTAAAGACGTCGTCCCAGAGCCGACG
ACGAAGCAGCAACGTGGGCCCAGGTATGGACGACAACATGAGCGAAGGACGGTCGGAGGACGTGTTTGCGACGCCGCCGA
CGTCGGCTCCCCACACGCCAGCGCGGTCACGGTCTCATACGATATCGAACCAGCTGTGGCCGGTCAAGGTGGGCGGCATA
CTGGACCGGTCGGAGACGGGGTCGGCAGCGCTGAATCCGCTGGTGGCATCACGGGTGGCGCAGGAGCACCAGGTGCGAGA
AATGCACCTGCAGCGCAACATGTTCACAGCGCTTCCGGACTCGTTGTCGTTTTTTGCGGAGACGCTGGCGGTGCTGTCGC
TGGCACGCAACGCGCTGTCGGGCGAGTCGTACCTGGGCGATGGGGGTGCGAGCGAGGGACTGGACCTACCGGTGCTGCGA
GAGCTGAACCTGTCGTCGAACCACATTACGGGGCTGATGCCGCTGGTGCGACAGCTGCGGGCGCCGTCGCTGCGAAAACT
GGATGTGAGCGTGAACCGGGTGGCGATGCTTCCGGCAGGCGGCCAATTGCGGGCAGCCTTTCCGGAGCTGTCGGTATTGC
TGGCGAGCGACAACCGGCTGTCGGAGCTGGATCCGGAGAGCATTCGGGGCCTGCGCATCGTCGACGTGACCAACAATGAC
ATTGAGCATCTCAATCCGCGGCTCGGTCTCCTGGGTGGTGTTGGCGGGCTGGAGCGGCTCGACGTGCTCGGTAACCGGTT
TCGTGTGCCGCGTTTCAATGTGCTCGAGCGTGGCACCGAGGCAACTCTTCGCTGGCTGCGCGGCCGTGTTCCCGTGGCTG
AGATGGGCATCTGGCGTGAGGCCAACCGGAGTAGTACGACCGGTGGTGGTGGCGGTGGCAGCAGCGGCAGCGTTGTCGAA
GTCGTCGACGATGAAGTGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62