GenePrediction:GLEAN_8295 Details

Name: GLEAN_8295
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:263519..262475 (- strand)
Length: 1045
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:263519..263438 (- strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_156:263192..262971 (- strand)
Length: 222
Type: CDS
Source: GLEAN
Position: GCSC_156:262887..262475 (- strand)
Length: 413
>GLEAN_8295 class=GenePrediction position=GCSC_156:263519..262475 (- strand)
ATGGACGGTGCCACGAAATCGGGTTATATTCCGATGAAGCTTGACGATGAGCAGGACGAACAGGTCAGGTCTCCCTCTGT
CGGTAAAAATGACTCACTAATCTAACGTCGAGCAGTATGTAAATATAGAGCATCCGAGAAGACAAAGTCGCGCAGGCAGA
TGGACTCTCCTGCTAAACTCGGTCCTCTTTCCCCTCTCTGTAATCTGTCTGGGGCTTGCTTATAGGCAGTCCCATCAGAC
ATACCAATGGCATTTGAAACAGATTTCAGCGTATTGTAAGATCAATAACGAAGTACATTGTTTCTAGAACCGGACTAACC
GTGCAAGCCCCGCTGCTGGACAATATTGACCTCGGCGAACCCGTCGCGCGCTACGAGATCAATGAGCTCTTTAACAGGCC
TTACACTATCTATCGTGGCGCTCCTTCTGACGAGGTCGATGCCGCTTGGGATGCCATAGCTGAAGTCGGCATCGTCCTCA
TAAGCGGCGAGGACGTCCGTGGACTTGGCAAAGATCCGTCCAGAACAGTGAAGGCTCCACCTGAATGGGGTGAGTACAGG
GGATTTTGTATCTCACGTACCATTTTCCCGGCGTCGCGCATCGTCCTAATAGATAATCAGGCTTTGGAACAGATGCACAC
CTTGCCCAAATTGATGGCCAGCACCAGATCCACTGCCTGAACGTCCTCCGCAAGTGGGGTCATTACGACTATTACTTCCG
GCCCAAATTTGGCGACGATCCCGGCTTGCTCCATAATTCCCATAGAGATCATTGTGTCATGCTGTTGCTGCAAACATTAA
CCTGCCAGCCGAGCTTAGATCTAATCACGCACAACTGGGTCGAAACGCAGCAGTATCCCGTACCGGATTTCAACATGAAC
CGCAAGTGTAAGAGCCACGATAGGATTATAGACTGGCAGAGGAGCAATATGATCACGATGGATCAATGGGACGAGATTCG
GCCGCAACCAGGAGACTTTTTCCTACCGTTATGGCCCGAACTGGTCGAAATAAACAAACAGAACGGATGGAATGGTACCC
GCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62