GenePrediction:GLEAN_8298 Details

Name: GLEAN_8298
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:910657..907925 (- strand)
Length: 2733
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:910657..910621 (- strand)
Length: 37
Type: CDS
Source: GLEAN
Position: GCSC_132:910559..910431 (- strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_132:910339..910190 (- strand)
Length: 150
Type: CDS
Source: GLEAN
Position: GCSC_132:909876..909796 (- strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_132:909726..908179 (- strand)
Length: 1548
Type: CDS
Source: GLEAN
Position: GCSC_132:908121..907925 (- strand)
Length: 197
>GLEAN_8298 class=GenePrediction position=GCSC_132:910657..907925 (- strand)
ATGGTTCTTGCCAAATATCGATCATACTACTGGCGCTGTCAGGGGCTATGTTCCAGACCTCGTCAACAGTGCTGGACAAG
CTAATTATACCTATCCAGTCTACAAAACCGTGAATTCCGGCGACGCACAAGGTTTTATCAAAGCTTTGACGTCTGATGGT
CCCAGTGGTGGTGCAAGAGACAACTGCTTTTTGGCTGGCGAGCCTCGCGTTGTGTACCTTCCTCCCGGTATGGTTTTGTT
ATCCAATTTTCTGAACATTGTACTTATAGTACTGCTTAGGAACTTATACCCTCACATCCACCTTGTTTCTCGACACAGAT
ACGGTCATAATCGGCGATGCTGCTAATCCACCAACGATCCGTGCCGCCGCAGGATTCAGCGGTGATTATCTCATCGTGGG
AGGCCAGGGAGATGGTACAAACCACCCTTGTGGAGGCTCTGGTGGAGAAACTCACTTCTCGGTAATGAGTAAGCTGCGGT
TGTTGACCATCTTGTTATTCTGACCAATTAATGATGTGTCTCTAGTCAAGAATGTTGTATTGGATACAACCCAAAATTCG
GGTAACAGCGATTTTGTTGCTTTAAACTGGGCCGTTGCTCAGAATTGCGCCCTGGTAGGCTTACAGTGACTTGGAAGAGA
GTACGACGACAATTAACCTAAGAACTATGATAGATCAATGTGCAAGTTACGATGCCTCAGGGCGCCCATACAGGTGCGTC
ATAGTCACAACCTGGGTTTTAATAGCCATACCTCTTCATCTAATTATCAACCCATGACTAGGTATTATCATGGGTGGAGG
ATCGACCATCTCCGTGTCTGATGTGACATTCAATTTTGGCAGCATTGGATTGCACTGGAATGGTAAGTTCTGTTGTCGCT
TCTCTTTGCGAGCTACAGGGTATGGGCATTGCTTACGATATGCTATTGCAGGTCATCAGCAGGGGCAGATTAAGGGAATG
ACCTTCAACAGTTGTACCACCGGCATCTTAATTGACGGGGGGTTCACAATCAGCATTTTGGCGCCAGCTTGTGATACGGT
CGGGTTCTGCATCGTTCTTAACTCTGGAAATGCCTGGGTCGCTGTCATCGACGGGAAAAGTACCAACTCGGGCGACTTCT
TCACGAGCAAGGTCAGCTACCCCAACTTTATGCTTGAAAATATATCCAAGGATACGGCCAGCTCAAGTATGATTATCGTT
GGCGATACTGTTAAAGTTGGTGGTGTGACGAGCCTCGGGACATATATTTACGGAAACACTCGTGGAGCCAACCCTACTTA
CCAGGACAACCCGACGGCGTCAGCAGTTGGCAGACCGTCCGCTCTCGCTCCCAGTGGCAACTATCCAGTCATTAGTGCGC
CGCAGTATGCAGACAAGACTATCTCTGATGTGGTGAATTTGAAGGATGCAACCCAGAATGGCGGATTCACACTTCATGGT
GACGGATCTTCCGACGACACTGCAGCACTTCAGGGTGCCATTGATACTGCAGCGAGTCAAGGCAAGATCGCGTATCTTCC
TTTTGGGATCTACCGAGTGACCTCAACCATCACACTACCTTCTGGTACGGAACTTTACGGTGAAGCCTGGTCCACGATTT
CTGGCTCCGGCAGCGCTTTCTCTTCCGAATCAAACCCAACACCGGTGGTACAAATTGGCAGCACAGCGGGACAAAAAGGC
ACGGCCCATGTTCAGGACATCCGCTTTACCGTCAACGAGGCTCTACCAGGTGCCATTCTGCTTCGAGTCAACATGGCTGG
CAACAGCCCTGGTGACGTTGGTATTTTTAATTCGCTCAACACCATAGGAGGCACACGCGACACGTCGCTCAGTTGTAGCA
GCGAGTCCAACTGTCGAGCAGCGTATCTAGGCTTGCATCTCGCAGCTGGCTCCTCTGCTTATGTCGACAATTTTTGGTCA
TGGGTTGCCGACCATGCGACTGACAATAGTGGAAAAGGCATCCGAACAGCTGTCAAGGGTGGCGTTTTCGTTGAAGCAAC
GAGTGGAACATGGCTTACGGGCGTTGGCTCTGAGCACAACTGGCTCTTTCAGCTTGGCTTCCACAACGCCGCCAACGTGT
TCATTTCCCTATTTCAGAGCGAGACGAACTACAACCAAGGCAATAACGGTGCCGTGCTTCCAGGGACACCATTTTCGGTC
ACCAGCTCCGACCCCAACTTCTCTTGGTGTAGCGGAGGTGACACCGTTTGCCGGATGGGTCTTGCCCAGTGGTATGTGGG
ATCCAACAGCGCAATCTATCACTATGCCGCAGCGAGCTGGAACTTTCAAAGCTTGACACAGGTCAATCAAGGCACCATGA
ACTATATCCACGACACGATTGGTGATGCCCATCTTCACGGGTTTACAACAGGACCAAACGTGGCTGAAACTATGCGATTA
CCGGATGGCGTTCAGTTCGGCAATGGCGGAACCGATGGATTTGGTGGATCATGGGAGTCCTTGGTGGCTGATATTATCAG
TCAGTCATAATGTGTCGGATGACAGAAGCCCAATGAGTGCGTGTGTATTGTGGAAGTCTATGGACTACCTCAGAGATATG
TAAATAGGAACACGTGCCGCCTGTACCACGCAATATACAAACATTCCCATCCCATCACTCCGCAGAACCTCAAGATCCGT
AACGAGGTGGCCTCGACCCAGACCAGCTTGGCCCAGGGCTACTTTCTCATGGACGACTTTGTCGGGCCATGGATAGTGCC
GGAGGTGCATTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62