GenePrediction:GLEAN_8299 Details

Name: GLEAN_8299
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_156:180374..181542 (+ strand)
Length: 1169
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_156:180374..180506 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_156:180566..180822 (+ strand)
Length: 257
Type: CDS
Source: GLEAN
Position: GCSC_156:181218..181291 (+ strand)
Length: 74
Type: CDS
Source: GLEAN
Position: GCSC_156:181431..181542 (+ strand)
Length: 112
>GLEAN_8299 class=GenePrediction position=GCSC_156:180374..181542 (+ strand)
ATGCCTATTTTTAGCGATGGGGAGCTCGTGACCTCGGTCGTCGTGTATCCCGGCAACACGGAGGTGCAGATGCTTATCCG
ATGGGCCAACAAGAGCCTGTTTCCTATCTATTCCATTTCCATGGGACGCAACCGTAGGCTTTTCCCCTGACGCTCGAGCT
TCGTCTTCCCTCACCTCTGCTTCACTCTCCAGTCAACCTAGGCCGTATGCGGGTTGCTCTGGATATCAGCCCCGACGATT
GCACCTGTCTGGTCGAGCCGGGTGTGTCCTACTTTACGCTATACGAAGACATACAGCGCCGTGGCTGGCTGACTAGCTGT
GGATCGACGTGCTCGACCTCGGCGGTGGCTCTGTCTTTGGCAACGCGGTCGACCACGGCGTCGGCTACACGTCCTATCAC
CAAGATGGACATGACCCTCATGCCTAGCCCCGGTGGCCACGAAGGCTCTGTGCGTCCTCTGTCCTGCTAATCGACCTCCT
ATGCAACCTGTGAGGCTGGACAAGCTGAAAAAAAGCAGATGTACACGTTTCTAATGACTCTTGCAGCTGTGGTGGGTGAT
TGCCTTTGCTCTTTCCTCTCTCGTCATGCCTTCCCATGTTAGAACTGCTTCTTCCTGCTTTGTCCTTTCCCTATTCGGAG
CCCCCGTTTTTATCTGCTGCCCCCCTTTTCATTTCCTCTTTGGGGATCTCCCTCACTCACTTGGCATTTAAGACTAAGTA
TTCCGCGTATCTCTTCTTCTCGTCTTTCAAATCGAAATCATCGTCCTCTGCTCATCTGCAACATTCTCGAAAATGCTGTC
CACATGTGCTACGTCAAAATTTGCCGCGTGCCGTCACCTACTAGGACAGTGCTGCCGGCCAGGTACCGCTTGAGGTGATG
TACACTGCTGCGGCCAGCCATCCGACCGGTGATCATGCGTGGGCTTGGTCTTTGACCGCACCGACGCTGCCAAGAAGGCG
GCTGCTCTCGGCTACAGTGAGCACCGTATGCACCTGGCCTTGATGCGCAGGTGGCGGCCATGTACAGCGGGAACGATGGC
ACGCCGTTGTGATACAGCATGGGCGAAATGCTGAAGCAGGACGGCTTCTGGGATGCCCAGCTTAGGGAGACACGGTTCAG
ATACGACGAATGCGATGCATGCTCTGCTATTGGTGCCCGCCAATCCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62