GenePrediction:GLEAN_829 Details

Name: GLEAN_829
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:278882..280614 (+ strand)
Length: 1733
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:278882..278990 (+ strand)
Length: 109
Type: CDS
Source: GLEAN
Position: GCSC_132:279056..280166 (+ strand)
Length: 1111
Type: CDS
Source: GLEAN
Position: GCSC_132:280233..280614 (+ strand)
Length: 382
>GLEAN_829 class=GenePrediction position=GCSC_132:278882..280614 (+ strand)
ATGTCGAAAATCTTCTCTTCATGGGCGTCCCGGGACTCGCCCGTGGCCAAGACCTCAAGCCTGGACTACGACCAGGATAA
AGTTGGCCCTAACGAGAGCAGCGATATCGGTATGGAGAAGAAACAGTAAATGTGTAGCAGAGGACCTCACTGACCGGCTG
TCCGTCCCTGCTAGGCCGCATCGAACATGCACGCGAGGCGAAGCGCCAGATCGGGATCCCGTCGGCCATTATGCTAATTG
TGAACCGCGTCATCGGCACCGGCATCTTTGCGACACCGGGCACGATACTATCGCTGTCGGGTAGCGTGGGCCTCTCGCTC
TTCATCTGGGTGGCTGGCATGTTGATCGCAATGGCGGGCACGGCCGTATATCTCGAATTCGGCACGGCGATCCCAAAGAA
CGGCGGAGAGAAAAACTACCTTGAATACGTGTACCGACGACCCAAATTTCTGACGACTGGCATGTACACCGGCTACGTCG
TGCTGCTGGGCTGGGCCAGCGGCAACTCGGTCGTCTTCGGCGAGTACATTCTCAACGCAGCCCAGGTCGAGGTCACACGC
TGGAACCAGCGCGGTATTGGCCTGGCCTGCATCACCAGCGCGTTCCTGATTCACGGACTGGCGCTCAAGTGGGGGCTGCG
ACTGCAAAACCTGCTGGGCAGCATCAAGCTGGTCGTCATCGTGATCATTGTCATTGGCGGCTGGATCGCGCTTGCCGGTC
ACGTGAAAGTGCCCGAGGACGAAAAGCCACACAACTTCCGCCACGCCTTCGAAGGCACCACCGGCAGTGCCTACGGCGTC
GTCACTGCGCTCTACAACGTCATCTGGAGCTACATCGGCTATAGCAACGCTAATTACGCCCTTAGCGAGACCAAGGACCC
TGTGCGCACGCTGCGCATCGCTGCCCCTCTGGCCATATGCGTTATTTCTGTGCTATACATGTTTGTCAATATCGCCTATT
TTGCCGCGGTGCCCAAGAAAGACATCATCTCATCCGGCCAGCTTGTCGCTGCTTCCATGTTCCGCAACGTCTTTGGAGGC
ACCGCTGAGCGAGCCTTGTCCGTCTTCGTCGCTCTGTCCGCTTTTGGAAACGTCCTTGCTGTCATCTTCTCCCAAGGCCG
TCTGGTGCAGGAACTTGGCCGAGAAGGGGTTCTACCCTTTTCGCGCTTCTGGACTAGCAACCGCCCGTTCAATGCGCCCC
TGGCCGGCCTTTTTGAGCACTGGGCTGTGTCAGTCATCATCATGCTGGCACCCCCTCCTGGCGATGCCTACAACTTTATT
CTCAAGTAAGTAGCTCAAGGCCCTACGTGCAAATTTGGGATAATTCAAGGCTGACACGGGCTTCTCCGCAGTCTTATCTC
GTACCCACTAGCCATCGTTAATTCGTTTGTCGCTGCCGGTTTGTTGTATCTGTACATCAACCGCACGGCTTGGAACTGGA
ACCCGCCGATCAGTGCCACTTGGCCGGTCGTCTTGTTCTTCCTCCTTAGTAACATATACCTTGTTGTCGCTCCCTTCGTG
CCACCCACCGACGGGCAAAGTGTGTATGTGCACCTGCCATATTGGATTCACTGTGTTGTTGGCTTCGGACTCATCTTTGC
CGGTGGAGTCTACTGGGTCATTTGGGCCAAGATTCTTCCCAAGATTGGCAGATACGAGCTGGTGCGGGAGGTTCAGGTTG
ATGAAATTGACGGATGGGAGAGAAACGTGTTTCTTCGAAGATCGTTGCATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62