GenePrediction:GLEAN_8301 Details

Name: GLEAN_8301
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:199907..202981 (+ strand)
Length: 3075
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:199907..200181 (+ strand)
Length: 275
Type: CDS
Source: GLEAN
Position: GCSC_167:200249..201008 (+ strand)
Length: 760
Type: CDS
Source: GLEAN
Position: GCSC_167:201355..201578 (+ strand)
Length: 224
Type: CDS
Source: GLEAN
Position: GCSC_167:201930..202137 (+ strand)
Length: 208
Type: CDS
Source: GLEAN
Position: GCSC_167:202178..202981 (+ strand)
Length: 804
>GLEAN_8301 class=GenePrediction position=GCSC_167:199907..202981 (+ strand)
ATGCCGCTACAAGAGCCACAGGCCAGACAGATTATCGAGAAGGCTCGCCAGGCACCCTACGGCAAAGGAGAGGAGACGGT
TGTGGACACGTCTGTCCGCAGCACCTGGGAGCTGGACGCGGGCCAGTTTGAGCTGCAGGGCCCTGCGTGGGAGCGCCTCC
TCGAAACTGTGCTGGCGAGCGTGAAGAAGAGCCTGGGGGTGGTCTCGCCTATTCGCGCGGAGTTATACAAGATGTTGCTA
TACGAAAAAGGTGCCATGTTCAAGGCACATACAGAGTGAGTCTGCCTAAGCAGTCGCAATAAGCTTGGACGTAGATTGCT
GACATGGAAAATGGATTGCTAGTTCTCCCAAGATCCCCGGCATGTTTGGCACGCTCGTCATCGTACTTCCCTCTATTCAC
CAGGGAGGCGAAGTTGTTTTGAGGCACCGCGGCGAGAAGAAGGTCTTTGCGTCCTCTCATGTGGCGCAGGGATTCATGGG
CTGGTATTCGGACGTGCAGCACGAAGTTCTCCCGGTCACAATGGGCTATCGGTGGGCTCTCACCTACAACATGACTCTCG
TTGATCCAGCTGCAGATCCGCCCTTTGCTAGTCGGCTGGGCCACGAGCAGCAGTCACATCTTTTCAGTGCAGTCGAGCAA
TGGATCGAAGGCGGGAGTGGAAGTCCTGTCTATACCCTTGATCACAACTACACCGAGGCTCGCATCTCTCTCCAAGCCCT
CAAAGGCAGAGATATGGCCGTCGTCCAGGCCCTGCGAGACATCTCATCCAAGCTTCCGGTGGATATATTTTTGGCAATCC
TGGAAAAGCAAGACACGGGAAGCTGTGACGGCGGCGATTATTATGGCCACTACAGCAAGCTTGTGCGCAACAGGTGCAAT
GAAGATGATGAGGACGACGAGACGGATGGAGGCGGTGGTGACTTGCATGGTCTGATCGATATTATCAGTACTACGCACTC
ATTCAAGAAGCTCGTCGATCTAAACGGCACTCATTTGGCCGAGGGTTTCGTCTTGTATGAGAAGGATTTACTAGTCCGGG
GTGCTTTCGCCAATGGTCGTGTGAAAGAGATCGACTTTACAGAGGGATTTTCCGGAAATGAAGTGAGTTGTAATTCCCAG
CAGGACAAAGCCTCACCGTTGAAGAAATTTAGCTGACACTCCATCCTTAACACAGGGAGGTCCAAGCGCCACTCATGCCT
ACCTAGTCTCGGTACGTAATGCTTGTCTTTCGACCTCAACGGTTACCAAACTAACATGTTGCTTGTACTAGGGCGTTGTA
TTAGTGCGGCAAAGATCCAATCATTACTTCATGCTCTCAGCTCTCGGCAAAGAAAGTGAGGTGTTCTACGGTTCAGGTTT
CAAAAACCTATGTTCTCTTATCTCGTACTACTCTGTCAAATGTGAAGACCCCTTCAGAGATGAGGCTCACCTCATCTTAC
TAAAGAAGCTATGCAACCGGGCCTGGCAGCCTCCAGTGACTGTATCACGGTATCGGAAGGATGTGGACGGGCCAGCGGCG
ACTCTTCTTCTTCAGGCTGCAGTGCAGATGAGGGATTGGGTGTTCTTCGACAAGGCGGTCCAAAATACCAAAAACGGATT
CACCGACACCTTTTACGAGTGGATCACAGGAGAGCTGGCAAACGGCTTGCCATTTGCGGACGTCAAAGAGCCGTAAGTCA
CCGTCCCTATCAGAAGCAGGCGTCTCTAACTTTTAATTTCACAGGCTACTCCACGCAGTGCTGTCTTTACCACGTATAGG
ACAGGCTTTTCTGGCAATCACCTCCATCACTATATTGAAGCCGAATACCCAACCAGGGACCGATAGCAAACAGGATTGGG
CACTCAAAGCGCTGGATGGAGTCCTAAATACATTGGGGTCAAAGACTCTTGAAAACCTAGACGGCAGATTGCTAATCACA
GTCTTCACTCGTTGCTACAATGTCGAACACATACGAACGCGGTGAGTCCTGGGCATCTGCATCCCACATAGACGGCAGAG
CGACAGCTAAACAGTGCGTGCAGAGTTGTGCCTCTTCTGGCGAAGCGAACAACGCACGTGCCAGTTTTTCTCGAAATCTT
AAGCAAGATTGCCGAGGAGAGTAGACGAGAGAGCGACGAAAAGAAGCTGTGGTTGGACATGTACGAGCTTCTGGTTACAT
CTCTGATCACATCCCTAGATATACTGAGCTTGAACGCGGAGGCAGGCGCAGTGTCTTCCCGTCCTGCCAAGGTGGCTCGG
CACTACTATGATGCATACCTGACCTTGCCAGAGCCCAACCCCCAAGGTGAAGGCACCCGCGATAGGGAGCAAGTGGCTCG
CCGAGCTCTACAAGGACCTACTTTCCCTGTTGCCAATCAGCGACCTGGCAATGAGGCTGGCGCAGAGAATCAGCAGAGCG
GCGGAACAGATCAGACCGGAAGAATTTGTTTCTCTGTGGATCCCGTTCCTTCAGCAGCTCGTCCCTGTGTTGGAGAAGAG
CTCGGTCCCACTTTCAACGCCACAGTATCAAGAGGTATTTGTGGCGCTTCTCGATGCGTATCTCAAGTACCACGTCTGCA
AAGAAGTCACGGATGAAGGCCGTACGCTTCAGCGACCGACAGTCCCGTGTCAATGTGGCGACTGCGCCAGATTAAACGCC
TTTCTTGGTAACTCTGAGCTGTGCGTCGGCCGCTTCGCTATCGGCAAACGCCGACGGCAGCACCTACACAACGTGCTCGA
TGGGGCCCGTATCGACTGCCAGCACGTCACCGAGCGGCTTGGCAACCCGCAGACGCTGGTGGTAAGAAAGACGTCCACGA
AACACGAAGCTGCACGGAAAGACTGGCTAGCACGAAAAACCGAGGCAGAGAAGCTGCTGCACTCGTTTCCCAATGAAAAA
TTGCGTACCCTCCTCGGAGCGGAGTATCTACGCATCTTTCATATGGAAGACATTCTGTGGTCTGAATGGAAGGTCAGTCC
TCAGGCGGTAGTGGTGCCTGGGCCACCTGTGCTTAGGCCATCTGTGCCGGCACGAGGCCTGAAGAGAAAGGCAGAGACAG
ATATTGAAGTGGTTGATCTTACGGGTTTGGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62