GenePrediction:GLEAN_8302 Details

Name: GLEAN_8302
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:932153..931332 (- strand)
Length: 822
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:932153..932099 (- strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_173:932029..931332 (- strand)
Length: 698
>GLEAN_8302 class=GenePrediction position=GCSC_173:932153..931332 (- strand)
ATGGAGCACGATGGGAAACGCCGCGCACGCAGCTACCCATACGAGAGCCGTTTGGGTTTGAGCCATGGTGTTGGGGGTGG
GAAGATGCGCGCATCGTAGCTCCATTCTGAAGAGGGGGGAGCAGCAAGCAGTGCCAGATGGACCGAGGACGACAAATCTG
ATGGACGTGAAACCGAGGAAGCTCACAGGGACAGGGTGCGGAGAGCTGGCTGCTGGCTGCTGGCAGAAGGCAATGATCAA
ACACGCGATTGTGATAGTGCACACAGAACAGGAGAAGAGGGTTGGCAGAAGAGGGGAAAGGGCCAGTCGTCGCACAAGGC
CGTTTACATGTGGAAGGCGCAAGGGGGGGCAGACTGCAGAACTGTTGTTCGGCCTTGTGCTTTCTCCACCAACGGCGAGG
CAGATACGGAAGATTGTCGCAACAAGAAGGAACGAGCGGCCGGCAAGCACGACCTCCAAGGCAGCGACGACGGCGACTAC
GTCGAAGTCCCCACCCAAAGCTGCAGCAGAAAACGACTTTCCAGGGGAGGGAAAGGCCTATTCTGCTTACGACACGCCAC
CCAGATTACATACGTACGAGTGCTGTGCATCTACCTGTGCAGCGTTGTGCGGAGACCTAGGAGGCCCTCCAGGGGCAGCA
GCCACCCGTTCAGGAACAGCCTCAAAGGTCAGATGCGCCGGTCGGTTTCCACCGTGCTCGTACTCGTAGCGGACGGGCCA
CTTCTAGTGTCGCCCAGCAGCACAGCCGCTGCGGTAGCGAGGCCGCGTGCTGGGGCGGATGTCCGCCAGATGTCGTTTCG
CCAAAACGATCGCTCCGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62