GenePrediction:GLEAN_8303 Details

Name: GLEAN_8303
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:929399..928652 (- strand)
Length: 748
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:929399..929371 (- strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_173:929151..928953 (- strand)
Length: 199
Type: CDS
Source: GLEAN
Position: GCSC_173:928873..928652 (- strand)
Length: 222
>GLEAN_8303 class=GenePrediction position=GCSC_173:929399..928652 (- strand)
ATGATCAGCGCTCTCGATGCCATGGCTCCGTACGTCCGTACGGAGTATTCCGTACGATTAGGGCAATACCAACAAGCTCA
AACAGCTAGTGCGCGGCCACTGCCAGAAAGAGAAAGAAAGACGGCGCAAGAGTTGCAAAAGCAAGGCCAGCAACGGTGAA
CGACCCCCCACTCCCCCGACACGGCATGAGCGAGTTTTGCTGCCGGTGCATCTCTCTCCACAGACGGCCCACAACGGTGT
GCGAACAGGCTCCTCTTCGTCGAGACACACGTCGCGCAGGTGAGGTACGACGTACTTCCACCTCCGGCAGTCGGCAGGGA
GGAGGAGGAAAAGACCTGGCGCCCTGCGTCCCGCCCTGCGCAAGTGCGACTAGTCGGACCCCTGTCGTACCTCGATGAGC
AAGTATCGTGTACCTCGAGCTCGACCCGTCCCCAAACGCTCGATTACGTATGCCAGACGGGACGAAAAAGAAGTCTGCAA
GGCCGCTTGTCTGAATGGCCGACTTCTTGGCTGCCGCTGTGAGCAGGGCCAGAACGGCCTCAGCATGCAGGCCGCTGTGT
ACGAGTACAAGTATCTTACAGCGGATGGGCGGAGGGTGGAAATGCATCCACCGTCCGTGTGTACTCGTATCTACATGTAC
GAGCGCGATACGTGGATTCTCATCGCCCCGACACGATCCAGGCACGGCATGCTGTTTGCGAGAGTGGCTTGCTACATACT
CACAAAGGTCATCGATACGCCGTTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62