GenePrediction:GLEAN_8306 Details

Name: GLEAN_8306
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2128553..2126810 (- strand)
Length: 1744
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2128553..2128532 (- strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_173:2128469..2127736 (- strand)
Length: 734
Type: CDS
Source: GLEAN
Position: GCSC_173:2127653..2127420 (- strand)
Length: 234
Type: CDS
Source: GLEAN
Position: GCSC_173:2127346..2126810 (- strand)
Length: 537
>GLEAN_8306 class=GenePrediction position=GCSC_173:2128553..2126810 (- strand)
ATGCTGGCAGAGGAATTGGTGGGTAAATGGTCGCAAACCAGACATGGTGACAAATTTCGAACAGAGGCTTACTGTCTGTG
ATAGTTGCCAAGGCAGACATTGAGCCAGACACGGTTCTCTTTACGATTCCTCGCAGTGCCGTTCTCTGCTGGGCTACCTC
GGAACTTTCTTCGTTGATCCCTGCCGTAGTGCAGAGCAACGGAGCTGATGATGAGCACGGCAGCGAGAGCGGTGAAGAGG
GCGGCCGCACTTCCCAGGACCCATGGACCTCTCTCATTCTCATCATGATCTTCGAGTTCCTCCGCGGCGATAAATCACCA
TGGAAGTCGTACCTGGACGTGCTACCAGCTACGTTTGATACGCCCATGTTCTGGACGGAAAACGAGCTACGCGAACTGCA
GGCCAGCCCAGTAGTTGAACGCATTGGGAAAGTCGAAGCAGATGAAATGATCACAAAAAAAGTACTACCGGTGATCAGGG
CGCACAGCGGCGTATTTTTTCCTAAAGGGTCTCAAGAAATATCAGACGAAGACTTGTTTGGGCTTGCCCATCGTATGGGA
AGCACAATATTGGCATACTCGTTCAGCTTGGAAAATGACGATAGCGATGACGAAGAGAAAGGCGATGGTTGCAAAGACGG
GTCTGGATGTGCATGTCATGGAGGCGACAAGATGGTACTTGAAGACGAAAACGGGGATGCCGATGCCGATGCCATTGAAA
GTGAAGATGATGATGGATGGGTCGAAGACAGAGAAGACCAGCTTCCTTTGGGAATGGTGCCCATGGCCGACATGCTGAAT
GCAGATGCCGAGTTCAACGTATGTTTACGCGATTGCTCAAAAAGACGAGGACACCAAGCTAACAAGCCACCGCTTCTTGA
CAATATATTTTATCAAACAGGCACACATTAATCATGGTACTGATGTTCTGACTGCTACATCTGTGCGGCATATCAAAGCC
GGAGAAGAGATCCTCAACTTTTACGGACCTTTATCGAACGGCGAGCTTATGCGACGATATGGTTATACGACTGAAAAGCA
TGAGCATTTTGATGCCATCGATATTCCATGGAAGCTTGTCTTGGATGCCATCGTGTCAAAGATCGGAATGAGCCAAGCTG
GCGTTGATAAAACGGTAAGTTGTCCGATTCTTGTTTAACAGTGCTGAACTCCCCATCTATAACTGCCGTTCTAACCCTTC
CTCCTAGCTTGAGTCGTTCGACCCAGATGATTTGGAAGATCCCCTGATGATTGACCGGGAATTTGACGAGGACGAGGAGG
CTGGACGTCTGGCTACACTGAAATCCGGCAAGATTCTTTCAAAGCTGCCGCCTGTCCTACGGAGGCAAGCACGCGCTTTC
ACTAAAAGAGCACTTCGAGAGCAGAAAAAGGAAAGACAGAAAAACAACCAGGTTCGCGATGCCCGCGAAGGACAAAATGA
TGAAAATGGAATTGCTATGGCTGCAGTCACAGATGCTATTACAGCCAGGCTATCGGCATATCCAACGACATTAGAGGCAG
ACTTGGCATTGTTGAGAAGTCTAGAAGAGAATGGGCCGACGCCAACATCCAGCCGGCTGCGCATGGCCTTGAGAGTCCGG
ATCGGCGAAAAGCGCCTGCTCAACGAAGCGGCAGTTTTAGCACACGAGGCGATCCAGGCCGGGAGTAATAAAGCAAAAAA
GGGTCACGAAGGGTCTGGGCTTGATGAACAAAGAGGCGCAAAAAGGCAAAGAACACGATATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62