GenePrediction:GLEAN_8308 Details

Name: GLEAN_8308
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_144:1455256..1454268 (- strand)
Length: 989
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_144:1455256..1455236 (- strand)
Length: 21
Type: CDS
Source: GLEAN
Position: GCSC_144:1454765..1454268 (- strand)
Length: 498
>GLEAN_8308 class=GenePrediction position=GCSC_144:1455256..1454268 (- strand)
ATGGCAGCGTTGGTCGGGCGTGTTGGTAAACACTCAACGGACTTGTTTGTGAGGCGGAGGTGAGAAGAGGAAGAGAAAAA
GAGGAGCACAGACGAGACATAAAAAGGAAAGAGACGATCAGCTGTTTCCCTGACCGGAGAGGGGATAAAGAAGGAAGGAA
CGACAAGGCCGGGGTGGAGAATAGGCAGGTGCACAAGCAAAGAGGAGCAAGACAAGGGGATCCGCTAGCTGGCACACTCC
GTACGGAGCAGTTATTGGAAAGGGAAAGGACAGGAGCAAGCTAACTTGTGGTGCTAAGCGACAGGTGCGCCAGTAATACC
TACGTAGTGTCCAAGTGGGGGATGCACAGTGCGGTGCAAGAGAAGGAGCATTTGGCAAGGGGGCCTAGTGAGCGTTACGC
TGGAGAAAACAGACAGCCCCGGGGGGGGGGCAATATACAGAATAGTACGAGTACTATGTACGTGTAAACTAGCCATACTA
CGAGTATGTAGGAGAGCGGCCGAATACGACACTGGGAGCAATGCGGCCGTCTCGACACCACGCACGCATCGAGAGAGCAG
CGGTCTGCAGCGACACCGGCGGTCCGGTTCGGACGCCTTAGTTGTGCCTGGTGTGCGAACGCTGACGAACGACGGGGCGG
CGAGGCAGAGCGTGCCCGTACTGGCAAGATAGCATACATTGTACGGAGTAAGCGTGTGCAGTGTCAGGGAGCAAGTAAGA
TCGTCGTCGCACAGGAGGCGGGCTTGGGGGCCTTCGGCCTGGAAACAACGCCCCGCTTGTCTTATTTTGACCCGACCGCC
CCTTCAGGACTTCTGCTAGCGCAGGTTTCGCAGCCTGCGGCTAGCCCAGAGGGGCCAGAGGGGAGTGCACTTCTGCCCGA
TGGAGTTGGGTTCGATGTTGTATGTAGAGAAGAGATCGAAGGAAGATACTTTGTACAGAGACGATGTGCTGCAACTCGGG
GCGACTGGGCAGAAGTGCTGCTCGTATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62