GenePrediction:GLEAN_8309 Details

Name: GLEAN_8309
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:742463..748059 (+ strand)
Length: 5597
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:742463..745564 (+ strand)
Length: 3102
Type: CDS
Source: GLEAN
Position: GCSC_140:745623..747628 (+ strand)
Length: 2006
Type: CDS
Source: GLEAN
Position: GCSC_140:748017..748059 (+ strand)
Length: 43
>GLEAN_8309 class=GenePrediction position=GCSC_140:742463..748059 (+ strand)
ATGGGACCGACAGAAACTGCTGCCTCAAGGCTTCTCGAGTCTCTTCCCGCACGACCACCCACACCGCCACGGGAGATGAA
TCATGAACCCGAGTTGCTTCCGAAACAGGTCGGGTTCCTCGATCCACGAAGCAGCCTGCAGACGCCTCCCAGCATACACT
CGCCTCAATCAGCCCGCAAGACTAGGAGTACGGGCAGCCGGAAGAAGGTAGAGTTTTCCGCACAAGCACATTACCAGGAA
GCACCTGTCTATCCCGGAGACATCTCCATCTTGTCCCAGCAGGGCCGTTCCACGCCTCCGATCGCCGTCATTCCGCCGTC
CTCGAGCGCCACCAAGCCGGCCAAGTCGATCCTCAAGGCCACCGCCTACGAGGCAACCATTGCGTACGATTCAACACAAC
CTGCTTCACCTGTGTTAATTGTCGATATGCTGGCTTCCACGGTGCAGCAGCTCGCGGGCGCCGACCGCGACTCCAAGCTG
GATGCCTACCTCACGCTCGCTCGCGCCCTGAAGGCCTCGGATAACCTCCCTGATCGCATCGCCCTCCAGAGCAAGATGAC
TCTGTTCACGCACTTCATCCAGCGTGATATCACATCGGCCAGAACGGCGGCCGGCACCCTCGACTCTACCATGGTCCTCG
CCGCTCTCGACTTGCTCAATACCTTTCTCCGCTTCTCGGCCATTGCCTCGACCCTTTCCAACGACTTTGGCGTCTTCATC
ATCGACCACTGTATCCGCTCCTTTGAGGTCGTCGAGGTACCCCGTACTGTTCTCCGCGCGCTGATGCGTGTCGTCGGACT
CCAGGGCTTTCCGCCCAAGGTCATGACGTCGGACCGCGTCGGCCGCCTGGTGGTGGCCCTGCATAACATGGAGGAGCAGA
TGGAAAGCCGGAATACGCTGTTGCTGCGCTGCATTATCTACCGCACACTGGTGAGGAACCACCGGATGCTCATGGCACAG
CACCTGGACTGGCTGCCCGACCTCTTCACGGACATGCTCAGTTCGGCGCCCATCATCCGCGAGGCTGCCATCAGCCTGGG
CCTTGACGCGGGTTTTGCGCTGGCTCGCGAGCGGCCGGTTACCCAGCGCGTCACGGATTTGTTCCAGACCTCTGTCGACG
ACGAGATGTACATTGAGTATTACGCCAACAGCTTGGTTGCCATGATCAAGGACAAGGACGACGCGCCGTATGTGCCGCAG
GTGTGGAGTGTGGTTACTCTCTTCATTCGCGCAGTCGAGAAGTGGGAATATTTCAATACGTGGCTTCGTATCATCCAGCG
TTGCTTCAACAGTCCCGACTACCGGACCAAAATTGAGGCCAACTACGCATGGTCTCGTCTCACGTATGCGGGAATGCGTG
ACCATCGGATTCTGCCGACAAAAATGGCCACCACCGTGACAAAGGCTCTGGTGTCGCAGCTTCGGCGACGGGGAGGGGGC
AAGCTTTATGACGACCACCGGCGGGTGGTTATTGGCACGATCTGCAATCTGTTCTACTATTCCATGCGCCCCAATACGGA
GTCCAGGGCGCTCGACAGTGCGTGGGATCTCAGTGTGAAGCCTGTGATCCTGCAGCTGCTTGAGCAGCCGGCCGTCAAGG
AGAGCAAGGAGAAGCAGAAGGCCAACCGAGAGACAGCAAGTGCTCTTCTCACAGGCCTCATCAACTGTTCGGTCGCCCGA
CCATGGCAGGAGGACCATGTGGTGAAGAGCCCGCTGGTGTTGCCGGAAGACCTGCCGGCAGTGGACGCCAAATGGGTGCG
GCGCAACTCGGAGCGCGTATTCGCCCTGGTTGGGCCCATTGTGCAGCAGAGCTTCCTGGACCTGGCTACACCGCGAAGCT
CGACGCAGATGCTCTGGCGGGCTGTAGTGGGAGCCGCCGCCGTGGCAGCGGCCAAGGAGGTCAAGGTGTCTACGGAGACG
GCTGTCTTTGTCAGCCACGCCTTCTCGCTGCTTCTGGCGATATGGACGGCGGGTGTTTCGACGACAGCGCAGACAGACGA
TGGTGACAAGAGCTTCGCAGCCAAGCAGATGCTTGCGGCCACACGCGAGTTTCTCCTGACCATGGTTGACGCCCTGGGCT
CGTTGCCGTTTACGGAGAAGCAGCTTGCCAAGGACGAGAGAAACGCGTTCGTGGCGGTCGGAACACCCTCACAGCGGACG
GGCAAGAGCCACTCGCTTGCCCGCTCTCCTCTTCACCACCTCTTCGCCATCCTGTCAAGCCTGCCTCCGGGGGTCCAGGA
CAACGACGACTTTGCTGACTTTATTGAGTGTGTCTTTGCCCCCTTTTTCTCTACCAAATCAGGCAAGGGTCGACGGATGT
TGGCACTTGGACTGCTGCAGACGATTCCGGCGGATGTGCAGTGCCCATATGGGCCCTGGCAGGCTGTCGCCAAGCGAATT
GCTTCGAGCATGGACGAGCAGACGGGCAGTACTGGTGGCAGCGGAACAGGAGCTGGCTACAACGAGTTTCAGCTCTCGCC
TGGCCCTGGCACCGGTGACGGCACACCAGTTGGCTACCAATACCGGGAGGTTGTGCGCGTCTTGGAGCGCGGACTCCGGT
CTACACCAGAGCTGCCATTCTCTCAATGGCAGGCCCTCTTCTGCACCCTCTGCGACAGGGTGCGGGAGAACACAGGGGAT
GCCGGGCTGGCCATGTGCGTCCTTGACCCGATGGCAAAGGCTGTTGCAGACCTTTGCGATGCCTCCTCAATCCAAACAAG
ATCGCCGACGGCAGCCCGGGCTATGGTCGAGTTGCTGTCTTGGGCAACACAGCCCCGAGACCGACAGGCTGTCGACGCGG
CCAAGCGGAGACTTTGGGGCACGGCCATCGCGACGGCCAACTCGACATGCTCTTCTGACCCGCTGGAGCATCTGTATGAG
GCTGTCAGCGTCGCCCTAAAAGAGCAGTACGGCAGACCAGGCTTGCAAAAGGCGGCTTCGAACGACCTGATTGCCTCGCT
TCTGGAAGAGCTGGCCCGTTTCTTTGCGCGAGGAAACGACCAGCTCTTCTTGAAGGCACTCGCCGCTATGCAGGATGGCC
TTGCGCTCTGGATCCGGGACGAGTCCGGGCTGCTCAGCCGGCAGAATCCCACAACGGAAGCTGTAAGTACCCACTGAACT
GATTGATTGTATTCTGGATGTTGCTGATTCTATTGTGCAGACGAAACGGGTGTGGGAAGAGCTCTGCACTCTGCTGGAGC
GCCTGAGCAACCAAGACAATTTCCCATTGGACGTGCTGGAGCCTCTGTTTTCTGCAGCGTTCAGCAGCAGACACCGGAGT
ATTGTCAACAGAGCGCTGGCTTTGTGGACGAGCAATTATGGCGGTTATGTCGGGACGATCGATTACCCCGACAAGCTGAA
GAAGGATCTGGCGGCCCTGCAGCCTTTTATTGACATTGCCATTCCCGGGCTGGAGGCGTCTCTAGTCAACACAGCGGATG
CTCGGCATCCTGTGTTCATAGACGACTCACAGGACGACGCCGACACGGACGCTGACGTGCGTCTACCGCCTATGGAGATC
TTGGACGTTGAAGTACCGACGTCACAGGCGGCATCATCTTCCTACCAAGCGCAATCGCCATTTGCGATCCCACTATCTCT
GCCTGCAAGGCGCCAGTTGGAGAAGAAAGCAACGGCTCCGAAGCCGCGACACGACGACTCACAGATCGAGTTTACCCTGA
TTGACTCGACGACGGGCTTCCCCAGCAGCAGCAGCGCGGTCAAAGCGGCCAAGGGCAGTTCGAGCGATGGAGACAGCGCA
GACGAGTCGCAGATGTTGACGGAGAGACAACGAGAAGTGCGAGAACGCCAACGGGAGACGAACGCGCTGTACTCGGACAT
GATCAGCTCTACGCCAACGCGAGCAGAGCCGAGAGCACCTCCTCCCAGGCTTCCGTCCGAGGAGCAGATGCAGGAGGACG
AGTCAACGCGATCGCTGTCTCCGATGCAAGACGACGTCCGGTTGCCGGAGCAGGTGCAGGTGATGACGCCGGAGAGGCAC
AACAGCGAGTATGCGGATGAGTTTATCGCGTCGACACCGACGCCTCGTCGCGGCCAGACGCTGACGCTGGCGGCCAACGA
CAACGACAACGACAACGATCCGCCGTCGTCGCCTCCGGAGCCGCGACGGTATCCCCTCCTGCCGGAGATGGGATCGAGGT
CACGCAGTAGCAGCAGCAGCATGTTGGAGGAGTGGCCATTTTCGTCTTCGCCGGTGACGGGCTCGCCGATAGCAGCGCGC
CACACAGCTCCAGAGCCGGAGCTTAGCCTCGAAGGGCTCACAGAAGCAGACGAGACGGACAGAGCGACAGAGCAGAGCTT
TGAGAGCGGGAGCTCGTTGGAAGACGTGTTTGCGGCGGCGGCTGCAGCTGCAGGATCGCGAAGACAGCGATCAGAGGGAC
CGTCGACGCCGACACGTCGAAGCGCGCGATGGCAGCAAAAGACGCCACAGGCGATGAACAGCCGAAGGGCAGCGATCCGG
GACGCGACCAAGTCGAGCCCAATAGGACGGACGAGCAGCGGACGGCGTCGGATCAAGATCATGGCAGCACAGTCGCCAGT
GGCCGTGGCAGCAGGTCCATCGCAATCGTTTCTGCTCAGCGACGGCGACGAGCGCAGCATGCTGCGACTGGCCATGGAGC
TGGACCAGCGGCGGCCACATTCGTCACCGGCCGAGACGACGACGGCCAGCCGCCGTGGCAGTGGCAGTGGCAGTGGTAGT
GGTAGTGTGGACGAGAATGGTCACGTGGATGAAAATGGTCACGTGGCCGACTGCATCACGGTGCTGGCCAGAGACGAGTC
GGCGAGACCTTTGGCCGGGCGACGGCTGCGAAAGCGGAAGCGCACAGCCGGCGAGGAGACGGGCGAAGCGGACGGAGAGG
ACGGAGAGGAAGGCGCCAAGACGGACAGGTCTCTGCTGGAGGACGAGGAAGTGCAGTCGCAGCTGGCGCTGGAGGTGCAG
GAGCGCAACGAGCGGCTGGGGCTGGTGGAGAGACGTTCAACAGCCGATGCAGAGGCCGAAGAGGACGGACGACCGGCCAA
GAGGACGCGGCTGGCCGGCATCCTGTCGATGCTCAAGGACAGCCTGGCGATGTTGAAGATGGCGGCGCTCTCCCGCGGCG
AGGTGCACGAGATCGAGGACGTGTGCATGGACATTAAGCGGGAGCTGTACGAAGCCGAGCTGCGAGGGAGGGGAGGGGAA
GGAGGGAGGGAGGAGTGAGGGAGCACATTGGCATCAGCTATAGCGTGTTTGGAGTTGTTTGGGCGTCTTGGGTTCTGGCT
TTCGACGGTTGCTTATACCTGCATGGCCGTTATGTACGAGATAGATCAATAGAGATGTGAGGGTGTGTATGTGTGTGCGG
TGGGTGTGTATTGGGTGTTTTTGTGTGCTGTAGTGTGGTGTGCGCTATAAAGTGTGCTGTAGAGGCTGTACTGGACCTGG
ATATTAGTCATGAAGGCACTGACGAGCCAGGAGGGACAAAACTCCCTCCAGAGACCATAGCTATTATTGGCTCTTACCCC
ACCTGTTTCAACCATGTCTGAGGCTACTCCGTAGTCTGGCAGCTGTCGCCGTTTTTGAACAGCTGCCCCGCCAGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62