GenePrediction:GLEAN_8310 Details

Name: GLEAN_8310
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:684798..685284 (+ strand)
Length: 487
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:684798..684945 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_173:685049..685284 (+ strand)
Length: 236
>GLEAN_8310 class=GenePrediction position=GCSC_173:684798..685284 (+ strand)
ATGGCAACTGGGCCGGCTTCCAGGCTGCTCGCATATGTCTTTTGGCAGATGCGCAACAATGGATTGACTGGAACTATAAC
GCGTTACTACGATTTGCCGGGCTTTGCTCCAGTGCAGGATGCTTACTTCTTTGTTCAGACATCAACACGTTCTTCAACAA
TCACGATCTCTCCTTTAATCCCGACGTAGCTATTCTTTTATTGTCCTCCTTCTATTTCTGTATTTCTGTATGTCTCTTCT
TCTTCATTCAGAACGACTATGCGTCATTTTCAAGGACACCCTCAGAGTCTTGGGGCAGAAACCCAACCGCCACCTCCTGG
ACCACCCAGCTCATCCAGCAGTTGTCCTCGAGCGGCAATTCCAGCAAGTAGTGCTGTTGAACAGGTGCGGTGAGGAGAAG
CCCATCTTCGAGACCCGATTTGATCCCGATTCAAACAACTTGGCGACCATTCTGCAAGGGCCTAAGCTGGTCGAACGGGA
GGTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62