GenePrediction:GLEAN_8311 Details

Name: GLEAN_8311
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_108:121868..122663 (+ strand)
Length: 796
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_108:121868..122249 (+ strand)
Length: 382
Type: CDS
Source: GLEAN
Position: GCSC_108:122350..122663 (+ strand)
Length: 314
>GLEAN_8311 class=GenePrediction position=GCSC_108:121868..122663 (+ strand)
ATGTCCGCCATGGCCGACTACGTAGAACGGGCGCTCGAGAGCCCGATGGCCGTTGCGATCGGCACCAGCGCGGTGGCCTT
TGCGTCGGGCATGCTGCTCGGCGCCTACTCCGTCCGCGGCTACCTCTTTTCGCCCGAGTTCCAGGAGGAGCGGCGGCGCA
ACCGGACGGACCCAATGGAGAGCGAAGAGTCGGATATTGACGACGACACCATCCTGGACCATGCGCCGAACTGGGCCAAC
GGCATGGAGGCCGATGTGCGGGATGGACTGCGGTCGAGGAAGAAGAAGGGCAGCAGCGCGGAGAAGAGCAAGGGCCAGGC
CGAGAGCGACGAGGAGTGCAAGCTGGTGTTGGTTGTACGATCAGACCTGGGCATGACAAAAGGTGTGTTTTCTATATTTT
CTTTTTTCTTTTTTCTTTCTTCTGTCTTTTCCTCCATCTTCTTTCCCCCATCTCCCTCTAACAAGGACAGGAAAAATTGC
AGCTCAGTGTGGCCACGCCACGCTTGCCTGCTACAAGACGCTGCAGCGGCAGGCTGCAAACGACCCCAAATCTCCGGCAG
CCCGGCTGCTGCAGCGCTGGGAGCGCCACGGCCAGGCCAAGATCGCGCTGCAGGACAAGGGCGAGGACGCGCTGCTGGCG
CTGATGGGCACGGCTCACAGCCTCGGCATTACGTCTGAGGTGATTGTCGACGCCGGCCGAACACAGATCGAGTCGGGCAG
CATGACGGTGCTCGGGGTTGGACCGGCGCCCAAGAGCTTGGTAGACAAGGTGACGGGACACCTGAAGCTGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62