GenePrediction:GLEAN_8314 Details

Name: GLEAN_8314
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1853295..1851471 (- strand)
Length: 1825
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1853295..1853206 (- strand)
Length: 90
Type: CDS
Source: GLEAN
Position: GCSC_173:1853145..1853074 (- strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_173:1853005..1852944 (- strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_173:1852878..1852703 (- strand)
Length: 176
Type: CDS
Source: GLEAN
Position: GCSC_173:1852641..1852034 (- strand)
Length: 608
Type: CDS
Source: GLEAN
Position: GCSC_173:1851971..1851782 (- strand)
Length: 190
Type: CDS
Source: GLEAN
Position: GCSC_173:1851727..1851471 (- strand)
Length: 257
>GLEAN_8314 class=GenePrediction position=GCSC_173:1853295..1851471 (- strand)
ATGGACATCATTTTGTTTTCAGAACTTCTAAAGAAATACGAGACTGTCGAAGAGAAGAAGACAACATGCATTGACATCTT
CAACTACTCTGTGAGTTTAGTTCATCCTAAACATTGCGGTGCGGATGCTCATCCCCCCTTGCGATTCCAGGATCCGACCA
AAAATCAGTATGACCAACAAAAACTGAGCAAAGATGACTTTCCAAACTACGTGAAGCGAGCGGTATGTTACCTTGGGAAG
ACCGTGCTGTTTGAGAGTATGGCTGATCATTGTGCTCATCACCGTCACAGGGTGTTTTTGCGCCGCCAGCTCTCAAAGGT
GGCCTAGAGTTTAAAAATGGCATACGATTGGTGTATGCTCTTTTGTTCACTACTGCAACAAGAAAAATCCCAACAGAGTA
GCTGACTACTTCCAAAGTGTTCAGGACAAGGCAGAATGTCCACACACCTTTGGTTCGGGGCATGTGCCTTTGCAGAAAGA
TCACTACGAATTGATGGTCCGTGAGATGCGGCTCCCATTCCTTTGGATCGAGACTACAGCAGCAGTGGGCCCGTTTTTCT
GGTGGACATATAGCCAAAGCCTCGGAATCATGCGTACGTATTGCCAAGCACTCGACACGAAGTGAAGCCAAAAAATCTGA
CTATGTGACCTCAGAGCTTATATTTCGAAAATCCGATGTGATGCGCAAAGATAATGTCAGCAGGGGCTGGGAAATGGCGC
TGTCTTATTCTTTCGATTCAAAAATCACCTCTGGCTTTGCAAAAGGGACAGAATCGGCGGAATTGGCTGCTGTCCTTGGC
CAGATGTCTGCATGTGCATCTCCTACTGCGCACCCCCTTCTCCTTCCCGTTCTAATGCTATGCAATGAAATCTCAACTAG
CAACGACTTAAGGCAACGCGACTTAAGGCACGAGCTTCGCGAAGTAGAGACTGGGATAAGCAACCGTTACCCGACAAAGG
AGCAACCAGGCCCAGAACAAAAAGCAAACCAAATAAATCTAGACACTCTCCACAGCCGGCTAACGGAGTGCCATTGCAAT
ATTTTGTGGAAAAACCCCAAAGCGTGGAAAGGCGTGGCCACTGAATTAAGGAAGGCAGCGAAGCTGTTTTGGAATACTAT
TCCTGTTGAACAGAAAGACTTGGGGTTTGCGGCCCTCCACAAAGAGCTTCTAAACAGACTAGATTTCGTGTCAACCAAGC
TGGACGGGTTGGATTGCTACAAGGACGTCTCTATCCAGAGGCTTGATCTTCAGCGCGATGTTGTATGTCCTTGTGTACTC
AATATCTATAACACTGGTTGTGATGCCATCCTGACTGGTTGCAGATGAGCAGTATCATAAGCCACCGAGAGTCGAGGATC
AATCTGTTGATTGCCATCCAACAGCAGCAGCTAGCTAACTCTAGCACGCGGGACAGCCTTTCCATGAAGACGCTGTCGTT
TCTGGGAATGTTTTTCCTTCCAAGCACATTCTTATCCTCTTTATTTAGCATGCCGTTTTTCAGCTTCGCTTCTGGTAAGA
AACTCATGCTAGCATTTGTGATATCAGATACTAACATCCGTGGCACAGATATGCATGGTTCTGTCTCGGGTAGACTTTGG
ATTTACTTTGTCGTCGGAATTCCGCTAACTGCCGTTATCGTTGGACTTTGGTATTTCTTTGACAGGCGGTCTCAAGCAAA
ATTCCAGCATGATTTTGAGATGATTGAAACCGAAATGTACAAGCTAGAGGGACGTGTTGCGGAAGACATATTCAAAAAGC
GGAAGGTGAGAGTTCTGACACTAGATTCAAGCTCTTCTACAATGGAAGCAAAGTCTCCTGTCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62