GenePrediction:GLEAN_8316 Details

Name: GLEAN_8316
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:1885100..1882535 (- strand)
Length: 2566
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:1885100..1883672 (- strand)
Length: 1429
Type: CDS
Source: GLEAN
Position: GCSC_173:1883619..1882535 (- strand)
Length: 1085
>GLEAN_8316 class=GenePrediction position=GCSC_173:1885100..1882535 (- strand)
ATGGCATGCTGTGCAGTGGCTGCGTACATTGTCTGGAGGTTGGTCAGCCTTCATGATCGGCTCTTTCAGATGTACACTAA
ATCAGAGGAGTATCTGTGCGAGAAGGAGAAGCAAGACAAGAGAAACGACGCTAAAAGGCCTTCACAACAGTACGGAAGAT
GCATTTTAACAGTCCGGGGCCTAAGCTGCAGTTCATGCGTTCGCCAGATCGAAGCAGCCCTTCAGACCCTCCCAGCTGTG
AGATGCGCACAAGTGTCGCTGGTGCTCCTGAGGGCAAGTGTGGAATACGACCCACGACACGCTTCATCGGCGGATCTTGT
TGCCGCCATACACAAGGCCGGCTATGAAGCTCAAGAGGACGAGCGAGCGACTGCAGAATATGGCCCCAATGGCCGTCACG
GCTGTATCCGGGACATGGTCGATTCTTTCTCTGCGTCCGAGGCCACCTGGGAGCAGAATGTTGCACAACACCGCCACGAC
TTCAAGGTCAGTGTGACACTGGCTGCTGTGTCTTGGATCGGCAGCAGTGCCTTCGCGTATATGACGCAAGCTTTCCCGTC
CTCAACATCGGCTTTGCCAGCCTTGCTTTTGGTCTTGCAAGCAGTGGTGGCTCTGGCGTGTCTGGCTGTGTCTAGACGTG
TCCATATGCACGCCCTGCAATCTGTGACTGGTCGCAGACCGCGGACGGTGGAGACACTGGCCTCGGCCGGCATGCTTACG
GCTATGGCAGATTATATTCTAGTATGGTGCCGTGAAGCCTGCGGAAACCGAGAACCGCATGTGTTCCCCCGTCTCGGAGG
CATAACTATGTTGTGTACCTCCATACTGGGTGTCCAGCTCCTAAAGACGGTGGCATCGCGGCACTCTCTTGGCCAAGTCA
CCCGCCTGGCCAGCTTATTCCCTCATACAGCGGCCGTCCTTACTGCTTCCAAAATCACTGAATCGACCTATGTCTCTGTG
GACCTAGACATGTTAGTGCCTGGGGACACGTGTCGGATTGGTACGGGAGACCGACTTCCAGCCGATGGCCACGTGCTGTC
GGGGACGGCCTGGATAGACGAGACCTGGATGACAGGCGACCATCAGCCGAAATCTGTGGACGCGGCCAGCGGAGATGCCG
TCTTTGCCGGTTGTACCATTATCCAGGGCGACATCGTGGTGTGCATCGACAGTTGTGGACCCAAGAGCAGACTAGGCCAG
CTGCTCGAACGTGTCTTGGCCTCAGAACAGACCACCGGCTCGGTCGAGCACGGAACCGGACTGTTTGTCGATACCATCCT
CCTGCTGGTGATCGTTGCAACAGCCACATCGCGACTCGTCCAGGACTTGTCGTGGACAGAGTGCCGCCAGAGCATGACCA
GCATGCTGGTGTGTGCTTGTCCTTGCACACTGGAACTCGGCGAGTCCATCTCGCTTATATCCGCTGCCGGTTCGTTCCCG
TCTCATTGTTGGCCATCCCTGCACATGATCTGACATGACAGCATCTGCGGCCAAGGCGAACATCCGGCTGCACACGAATC
CCCGACGGATAGAAGATGCTGGTCGGGTCAAGACGGTGCTGTTGGACAAGACCGGAACTCTGACAACAGGGGTGCTGAGT
GTCAGCTGGTGCGGCCTCGCACCTCACTGGATGGAAACAGAAAAGTCCAGGGCCGAGTGGTGGGCACTGGTCGGTGCCGT
TGAGCAGCACGACGATATTGCTGCGAAGCATCCACTGGCTCGAGCCATTCTACGGGAAGCCCAAGTGCAAGCGGCATCAG
CCTCGGCAGCCGACAGCCGTCCACGCGTATCGGTAGTACGTGCGGACTACGAACCAGGAAGAGGCGTGCATGGCTGGCTT
GTCTTGGGTGATAACACTCCTGCCATTCCAGGCTCTTCCATTAACGCCCGCCATGTTGTCGTGGGCAGCCGCAGCTTCCT
CGCAGCTTTGGGTATCGAGCACGACATGTCATCCGTTCCCGAGACAGCACGCGCAGATGTGGCCACGACCGTCTGTGTGG
CCATCGACCGGAAGCACGCGGGCACTCTGGTCTGCCGCGACGTTGTGCGGCCTTCTGCGCTAGAGCTCGTGCGCAGGCTC
TCACAACAGGGCGTGCGCGTTGGAATGATCACGGGAGATGCTTGGAGTGCCGCGCTGCGAGTCGCTGGTGCCGTCGGCAT
CTCTGTGGAGAACGTTCATGCAGAGCTGCTTCCGCTGGACAAGGCCGGCGTCGTTCTAGCGGCACGGCGGCGTGGCCCTG
TCGTGGTTGTTGGTGACAACCTCAACGACACGGGGGCGTTTGCTGAGTCATCATTTAGTATCTACGTCGGTTCGGATACG
GTCTGTGCTGGCGAAACCGATGCGATGCTGCTGTCCGGGCAGACACGAAACGACGCGGCCCATGTGCGTGTTGATCTAGA
ACAGATACAAGACGTCATTCTGCTGGCCAAGACAACGATGGACCGCATCCGACAAAACCGGTGGGCAAGCCTGGCCTACA
ATATTGTGGCTCTGGCTTTGGCGTCTGGCCTGCTGCAAAACATCCATCATCGCCTGTATTTCTCGCCGTACGTTGCCCTG
CTTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62