GenePrediction:GLEAN_8319 Details

Name: GLEAN_8319
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:2355020..2353718 (- strand)
Length: 1303
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:2355020..2354848 (- strand)
Length: 173
Type: CDS
Source: GLEAN
Position: GCSC_113:2354626..2354265 (- strand)
Length: 362
Type: CDS
Source: GLEAN
Position: GCSC_113:2354208..2353718 (- strand)
Length: 491
>GLEAN_8319 class=GenePrediction position=GCSC_113:2355020..2353718 (- strand)
ATGGCTAAAATAGCATCTGAACTTACACCACCTGATAGCCCCGGCCAGAAGGCTCGTCTGAGCTCAGTTCTTCCCAGCAG
TTATGACAGCACGCTGAAACTCATCGGGACAACCAAGTTCGAACCGAGAAGCGATATCAAAAACATTCTCATAACAGGAG
GCGCCGGTTTTATGTTAGTTTTCTATTCGATAAAAAGATCATCTTTAACAATGCTGATATTTTTAGTGGGAGCTGGGTAA
CTAGACATCTAGTGGTCCAGTATCCCGAGTACAATGTCATCTGCTTGGATAAACTAGACTATGTCTCCTCGATGGCAAAT
ATCGATTGCTTAAAGTCATTTCCGAATTTTCATTTCATCAAAGGAGACATTACTTCTGCAAGTGCGATTGACAGAGCACT
GTCCGACCATAACATCGACTGCATTCTACATTTTGCAGCCTGCTCCCACGTGCAGAATTCCTTCAACGACCAGCACAGCT
TCACCTTGAATAATGTCATTGGAACGCACAATTTGCTCGAATGCGTCCGCAAGCGTGGTCGGATAACCCGCTTCATTCAT
GTAAGCACTGACGAGGTGTATGGCGAAACCCCTGACGAAAGTGTCGACGAATCCAAGCAGTTTCTGCCAACGAACCCGTA
TTCAGCATCAAAGGCGGCAGCAGAAATGTACGTGTACGCCTACTTCAAGTCATTCGGCATCCCGGTAGTGATCGTCCGGA
GCAACAACGTGTTCGGACCGTGTCAATACCCCGAAAGTAAGTGCAGTAATATTCCATACGATTGAAAATATTAATATGCT
AAGAATGGACAGAGATTATCCCGAGGTTCTTCGCCTTACTGTCAAAGGACCAGCCACTCACCATCCAAGGCTCGGGTCTG
CACCGACGGCGGTATCTGTACGGGAGCGATGCGGCAGACGGGTTCGATACGATCCTCCACAGGGGAGTCGATGGCGAGGC
ATATAACATTGAGTCCGGTGTCGGGGTGACAAATCTCGAAGTCGCAATTCGCATGCTCCAGCTCTTTGGCTACGACTCTG
AGTCCGATTTTGCTACTAGACTGGCGTGGGTTGCGGACCGACCTTTCAACGACCACGATTACCGCGTTGATGGATCCAAG
CTTGCAAACTTAGGATGGAAGCAAAACATACCATTCGAAGTCGGTCTCACAGCCACGGTAGACTGGTACAGATGTAATAT
GAACGCCTGGTGGATGGATGGAAGTGTGGATGCGATCTCAGTAAAGACGCTACCGTTGGATGCGGAACGACTCAAAGACT
CAACAGTGCTTACGGGAAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62