GenePrediction:GLEAN_831 Details

Name: GLEAN_831
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:290825..291279 (+ strand)
Length: 455
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:290825..290833 (+ strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_132:291064..291279 (+ strand)
Length: 216
>GLEAN_831 class=GenePrediction position=GCSC_132:290825..291279 (+ strand)
ATGGACACTGTGAGTACGATATATGCACTCGTACGGAGCTTCCCAAGATCTGCATCACGGGACCAGCCGCCAGCTCGTCT
TACTAAGGCATAACTTAGCAAAAATAGCGCGGGCCAAGAAGAAAAGTCAGTCTTGGTCGTGAGCACTACTTCGTACAAGG
CGCCTATCCCGCCTGCCAAGTGGTGTAGCTCCGTCTCGAACGAGGTTGGTAAGCAAAAAAAAGTGGCTCGCTGGGCTAGC
TACGGAGCATCCGCGCCCTCGCTAGCCTACTCAGTGGACCGGCCCACGCTTTACTGCGGAATCAGGGCCTGTACGGAGTA
CGAGTAGAGCCTTGGCCAGCAGAAGCCGCACTATCTTACGACAGGTCCCAGGACCAGGCCCAAAACGCTTTATCTGCGTG
TCAGACGACGTCGCGTGTTGACGTGCGCATCTGCGGCCACCGAAGGCTGTGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62