GenePrediction:GLEAN_8320 Details

Name: GLEAN_8320
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_113:138580..139864 (+ strand)
Length: 1285
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_113:138580..139627 (+ strand)
Length: 1048
Type: CDS
Source: GLEAN
Position: GCSC_113:139701..139864 (+ strand)
Length: 164
>GLEAN_8320 class=GenePrediction position=GCSC_113:138580..139864 (+ strand)
ATGGCCCCCGGCGCACTCGTGTCAGAGACCTCAAGTGTGGGCAGCGGGCTGTCAGGAAAGAGGAAGAACGACCAGGCGCC
GCGGTCTGTTTTTCCTGATGGCATTCGCACGTCAGGCCAGCACCCCCCCCTGTACGAGCAATTGCAGCCGTACGCCGACT
TCCCCAAGGAGATCACAGGGCCGACGGTGTGGAAAAAAGATGATTACGAGAACAAACCCGAGCGCTGGGTGCACCGGTTT
ACGGCAGAGGAGATTCAGGAGCTGAGTGACACGTCGGATGCTTTTATCGCCAGTGGGACGCCTCTGACAGGCATCTCCAA
GAGCAACTTCCCACTGCCCAAGTTGTCGGCAGCACTTGCGCGAGTCCGTACCGACCTGATAGACGGCAAAGGATTTGTGC
TCTTCAAGGGCTTCCCGGCGGATATCTGGGGTCCGCACAAGAACGCGGTCGGTTACATGGGATTGGGCACATACCTTGGA
TACTTTGTGTCGCAGAACGGGCGCGGCCATGTGCTAGGCCACGTCAAGGATGTCGGCGACGACCCGACACAGATCCACAA
GGTTCGTATCTACCGCACGACGGCGCGGCAGTTTTTCCACGCAGACAACGGTGACCTCGTGGGGCTGCTGTGCGTGCACC
GTGCGCTCGAGGGCGGCGAGAGCGACATTGTCAGCGTGCACGACGTTTGGAACACGCTGCAGCGCGAGAACCCCGACGTG
GCCGAGCTGTTGACGCAGCCGATCTGGTACTTTGACCGGAAGGGCGAGGTATCCGAGGGCGAAGAACCCTACATCCGCCA
GTCCGTGTTGTACCTCGAGCCCGGCGGCCAGGAACGTCTGTATATCAAGTGGGACCCATACTATGTGCGCTCGCTGTCTC
GCTTCTCCGACCAGGGTCTGATCCCGCCCTTGAGTGCCGAGCAGATACGCGCCATACAAGTTCTCGAGGACACCTGCCAG
CGCCTGTCACTGCACATGATCCTCGAGGTCGGTGACATCCAGATCGTCAGCAACAACCACCTGCTGCATGCGCGGACGGC
ATACAAAGGTAAGTCGCAGCGGGGTGCACGAGCTCACACTGGGGAACTAGAGCTGCCTTTCTGACCAATCGCTCCTCTTA
GACTATCCTGCACCGGAACCCCGTCGTCATCTCTTGCGTCTGTGGTTGTCCACACCCGAGAGCGAGGGCGGCTGGAAGTT
GCCCTACCCCGACAGCCTGGAGCTGAAGCGGGGTGGCATCCAGGTCAACGACACTCCACCGACGTGTCCTCTGGATGCCG
AGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62