GenePrediction:GLEAN_8321 Details

Name: GLEAN_8321
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:1865863..1867392 (+ strand)
Length: 1530
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:1865863..1866891 (+ strand)
Length: 1029
Type: CDS
Source: GLEAN
Position: GCSC_140:1867051..1867158 (+ strand)
Length: 108
Type: CDS
Source: GLEAN
Position: GCSC_140:1867276..1867392 (+ strand)
Length: 117
>GLEAN_8321 class=GenePrediction position=GCSC_140:1865863..1867392 (+ strand)
ATGATCTCTCACGAGTCTCACGACGGAATGGCTGATCGACAAGAACAGAAAGACAGCAGTCCGCACGAGGCTCTGTGCCG
GCTGAGTATTTCAGCCGCACGACAGATTGCGTCTGATTGCAGCGGGACGGGAGAAGGGGATGCTAGGCTGCGTGAGTGCG
GCGCGCCGTTGGTGCAGCTGCTAGGTCGACAGGCTCAGCAGGTCTTGAGGTTCGCAGAGGGGAGGACAGAAGAGGACGAT
GTCAAGGCGATGGGGCTGGTCTCGCGGCGGCTGGCCGACCTGGTGGCCGTGGCGCACGGGCGCTTCTATGCCTTTGTGCC
GAGCGACGTTCCGGCCTGCTGGCGACAGCTCTACACAGACGCGAGCATCCTGCAGTTTGCGCAGCGATGGTCGCAGCTGG
CGCGGGACGCAGACGCAGACGCAGACGCGACCATCGGCTCCAGTCTGGATCGTCTGGTGCGGCCTCTGGACATGGCGCTG
ATCCTGGCAGGCGGAGCCGGGCCGCGTGGTCGAGGTCGAGGCTGGATCCACGCGGCCCTGGACGCACTTCAAGGCGTGTG
GGAGGCGGGGGAGGGAAGAAGCCAAACCCGAGACTGGACTGCGTGTCCGACCTTTGCTGGTCCGGCCGTGTCTGTCCCGC
CGGTCAGCCGGCCGGTAGAGCGTCGGGGCCGGCTCGGGCTCGCGGGCTTTCAGGCGTATGTGGACGGCAGTCGCCGTCGC
AGCGAGGGACCACAGCCATTGGTTATGACCGGCCTGACAGACCACTGGCCGGCACGCCGACCGGTCGACGGCCGGCCCTG
GACGGTGCCGGCATATCTGCGATGGCGCACGTTGAACGGCCGGCGACTGGTGCCGGTCGAGATCGGCCGCAGCTACGTGG
ACGCGGGCTGGCGACAGGCTGTGGTGCCGCTGGCAGACGTCCTGACAGGGCTCTGCTCTCCAGAGAGAGACGCCGACGAC
GCCGGCCCTGTGTATCTGGCCCAGCACGCACTCTTTACCCAGATGCCGCGGCTGCGCGACGACATCTGCGTGCCGGATGA
GTGCTATGCCACAATGGGCGACACCGACGACATCGACGACATCGACGACATCGACGATGCGCAGGAACCGCTCGTGCACG
CCTGGCTTGGACCGGCCGGCACCATTACACCCCTGCACACAGACCCGCACCACAACCTGCTCGCTCAGGTGGTCGGTCGC
AAATACGTGCGGCTGTACGGACCGGCACAGACAGCCGCGCTGCGGCCGCGCGGCTGCGAAGGCGGCGTCGATATGGGCAA
TACCAGCAGCCTGGACGTGGGCGTGGAGGAGGGCTGGGATTTGAGTGGTGGTGGTGGTGGTGGTGATGGTGATGGTGATG
ACTTTGATAGTGGTGCCAGTGACCACTATAAATCAGACCCCACTTTCCATCAGATCCCCTATGTCGACTGCATCCTCGAG
CCTGGCGACACGCTGTACATTCCGCGCGGCTGGTGGCACTACGTGCGCGGACTGACCGTCAGCTTCAGTGTCAGCTTCTG
GTGGGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62