GenePrediction:GLEAN_8322 Details

Name: GLEAN_8322
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_140:4107074..4108866 (+ strand)
Length: 1793
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_140:4107074..4107336 (+ strand)
Length: 263
Type: CDS
Source: GLEAN
Position: GCSC_140:4107387..4107740 (+ strand)
Length: 354
Type: CDS
Source: GLEAN
Position: GCSC_140:4107807..4107853 (+ strand)
Length: 47
Type: CDS
Source: GLEAN
Position: GCSC_140:4107903..4108622 (+ strand)
Length: 720
Type: CDS
Source: GLEAN
Position: GCSC_140:4108685..4108866 (+ strand)
Length: 182
>GLEAN_8322 class=GenePrediction position=GCSC_140:4107074..4108866 (+ strand)
ATGCCGTTAATAGAGGCTTTCTTTGACCAGATCAGCACGATCCTGGGGCCAGACAACGTCTCCCGGGATTCGTCTGCCGG
GGCGCTTGTCGGTCCAAAGGGAAAGACGGCCTATGGCGACCCCTACCCGCTAGACGAGGCGGTAAAACGCTCGCCCGTCG
GCGCTGTTCGGCCCAGCACGGTCGAGGAGGTTCAGGCAGTCATCCGAGCGGCCAATGTGTTTCACGTCCGGCTCTGGACC
GTGTCGCGCGGCAAGAACCTTGGGTGGGATTTTCTGTCCAGCTTCAATGCAATTCGAGTTGCTGATCTCTTAGCTATGGC
GGCACCTGTCCCGTGGTCAACGGCACTGTCGTTCTGGACCTGCACCGAATGACCAAGATCATCGAGATCAACGAGGAGTT
TGGCTATGCCATTGTCGAGCCTGGTGTCTCCTTCTTCGACGTATATGAGGAGATTCAGAAGCGGAAGCTCAAGCTGTGGC
CGTCCTGCCCAGCAATCGGCTGGGGCTCCATCCTCGGAAACACGCTGGACCGTGGCTTCGGCTACACACCCGGTGGAGAG
CACTCGCAGGTCCAGTGCGGCATGGAGGTCGTCCTGCCCAGCGGCGAGCTGCTTCGCACGGGCATGGGGGCCATGCCCGA
CAGCAAGCTGTTCGGTCTGTACAAAGGGTATGTTTAGGTTCACGGATCCGGATCGCAAGAAGGCCGTTGCATCAGAGCAC
TAACTGGCTGCAGAGGGTTCGGTCCAAGCATCGACGGCCTGTTTTTTCAGTCCAACTTTGGTACGTCACCGCACTTCTTC
ACTCTCTGCATCCCAGACTAACATCGCAGGCGTTGCAACCAAACTCGGGTATCACGTGACACCCGCTCCAGAGGCGTACT
GTCGCTTTAAGATCAACTTTGCCGAGGAGGAGGACCTGATCCCGATGATCGACACACTGACGGACCTGCTGCGGCGAAAC
ATTATCGGCAACTCGCCGTCGGTGTCCAACATCTTCCGCGACGCGATCGTGTCGGGCGACCCGGACGCGATAGCCGCAGT
GAAGCCATATCTGGGCACAGACAAGTACGTGCCGTATGATGTGATGGACAAGCTGCGACGCCAAAAGGGCTGGGGCTTCT
GGACGGCACACTTTGCGCTGTACGGCTCGCGCGAGGTCGTTCCGGCTCTACGAGACACGGTCAAGCGGGCGTTTGCCAAG
GTGCCCGGGGCGACGATCAAGGAATGCGAGCTCTACACAGCACCGGAAGACGAGGTGCTGAATGCGAGCATCGTCGGCGA
GGAAGAGATCCCCAACACGGGCGTGCCGACGCTGTCGCCGCTCGGCCTGCTTGACTTTGGCCGCGAGCCGGGCTCGTACC
ACACCTGCTTCTCGCCGCTGATTCCGCCATCCGGAAAGGCGCTGTACGACTGGTACATCACGGCGAAGAAGCGGACTGTC
GATGCGCGCTTCGACTTCTTTGCCGACTTCCACGTGTATGCGCGCTACGTCATCGGCATCGAGCTGGTCATGTACACGGA
CGCGGAGAAGGAGCGGATGAAAGGAAGCTGTTCGAGGTCCTGCTCGAGGATGCTGCAGCTCAGGGCTACACCGAGTATCG
CACGCACGTAGCCTTTATGGACGACGTGGCGTCGCACTTTGACTTCAACGGCGGCGTGTTCAACAAGTTCCTGACCCGCA
TCAAGGACAGCCTTGACCCCAACGGCATCCTGTCGCCGGGCAAGTCGGGCGTGTGGAACTCGGCTGGACCGGGATCTCGG
TTGCACGGCGCGTCCGAGGTGCCAAAGCTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62