GenePrediction:GLEAN_8327 Details

Name: GLEAN_8327
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_173:2014683..2011876 (- strand)
Length: 2808
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_173:2014683..2014588 (- strand)
Length: 96
Type: CDS
Source: GLEAN
Position: GCSC_173:2014145..2014104 (- strand)
Length: 42
Type: CDS
Source: GLEAN
Position: GCSC_173:2013806..2013716 (- strand)
Length: 91
Type: CDS
Source: GLEAN
Position: GCSC_173:2013599..2013577 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_173:2013509..2013491 (- strand)
Length: 19
Type: CDS
Source: GLEAN
Position: GCSC_173:2013370..2013248 (- strand)
Length: 123
Type: CDS
Source: GLEAN
Position: GCSC_173:2013178..2013156 (- strand)
Length: 23
Type: CDS
Source: GLEAN
Position: GCSC_173:2013097..2013060 (- strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_173:2012960..2012936 (- strand)
Length: 25
Type: CDS
Source: GLEAN
Position: GCSC_173:2012882..2012770 (- strand)
Length: 113
Type: CDS
Source: GLEAN
Position: GCSC_173:2012701..2012282 (- strand)
Length: 420
Type: CDS
Source: GLEAN
Position: GCSC_173:2012185..2011876 (- strand)
Length: 310
>GLEAN_8327 class=GenePrediction position=GCSC_173:2014683..2011876 (- strand)
ATGGCCAGCCTTCCTGCCGAAGCGCATACACTACTACAACCGGTGGCCGGTGAAGAGCTCCTACCTGCTTCCGGTCTCGC
TCAAGAAGAGCCAATTGTGAGCTTCCGCCTTCTACCTTTCTTTTAATCATTTCCACAACAGGCACGCCGATCCTGTAGCC
TTACCGTCGGAACGAGCCGCGAGAGGGATTGGCAAGACTACAGGTCGACGGTAGATGGGCGTGCTACCTTTGCACGAACC
AGATATGCTTACGGGGTTTAACGATGTATGCCGCACGCAATAAGCATGGCTTTAAACAATATGGGCGAAGAGCGCTAATG
CAACGGCCCATACCGGAGTAAGGATGTGAAGCGGAGTGGGGGCCGGGAGAGGAAAGAGACAGGCAGTTCAAGAGACAAGC
AGAAGATGCAGAGAGAAAGAGAGAGAGAGGGGTGACAGAAAAATGAAGCGAAGCCAGGAGAAAACAACTGGGTCTCACCT
CTCCTTGTCTCCCCACCCACTCACAGGCTTGCTCCATTTTGCCGTTTCCATTTCTTAGGTTGCCGATAATGACGATGACG
GCGATTCTGCAATCGATGCAGTAAGTGTTGCTGCTGATTCGATGATGATCAGCACCTGGGAGGTTCCTTCAATTCTGCCG
TTAATTGCTGGCCGTCGCGCCTTTTCCGTGGGCCGGGGTGCGGGGCTGTAATTTTCCAGATGCCTGAGCTTGAGGGCTCG
CCCCTGCTGGAACTCACTCATACACTGACTGGGTCGGACCGTCACGCTGCTCTACAGAATTAGACATAACAAAAACGCGA
GACAGGAAACAAGAACGAGGGCAGAAAGTGGAAACAAATGCGGTCAGCATAGATTGCGGGAAAGCTGACATCTGCAGCCA
TTTCGAGAATCGTTGGCCTCACTGCGGTCCAGCATCTTGGCTTATCAAGAGGAGAATGGCCGCACCTATCACGCGTTGAG
TGCAGGCAGTATGTCGCCCCGTCCTTGTCTTTTAAGACCTTTCTCCCGGTCTACCTCTCAGACCTTCGTCTGCCCTTTTC
GTCTTGACCGACTGCTGACCGGTGTGAATTCCGTGCGACCGCAGAATACTTCTTGCCCAATGACGAGGTGATACTCTGTC
CTTCTTGTTTGGTTTGCATGTGGTTGGCGCTGATTGTGTCTGTGTCTGTCTTAGGCTGAAATCGAGCGTCTTGGTGAGTC
TCTCCTACCAAATCAACCTGGCCGTCACACCCCATCAACGACTTGGGCAAATTTTGGCTAATGCGACCTCCCTCAACCTT
TTTTTGCCGCTGCTTGCATCGTTGCCCGAACAGACTTGCAACATCATGTCATGCGCCTTACAATCGAGGGCAACTACTGC
CTCTGCCCCAAAAACGATGGCGCAAAGCGGGTCCTCGACATGGGCACCGGAACGGGCATATGGGCTATGGAGTACTGTGT
GTCTTCCCTTGCCGCTTCGAAGCTGACTCTTTGCTGCCAACTACTTGCAACTAACTCTTCACCAGCCGATGCCCATCCTG
ATGCGGAGGTGTCTCTCCCTCCCCTTGTTTTTCGTCTCGGTCGCTAACGCAGACTTGTGCTACCAGGTCATTGGAGTCGA
CCTGAGTCCTTTGCAGCCAGAATTGTGTGATGCGCATTGTTTCTTGCTTTCTTCGCCCCCCCCCCCCCCCGGGGGAAAGT
TTCGTCATCAATTTCTAGTGAATTGCTAACTGTTACATTTCAGTGTCCCACCCAACTGCTCCTTCGAAGTGAGCCCAACT
TACTCAAATCCTCTGCCGTGTCACTTGATTGACTTTCACAGATCGACGACCTCGAGAAACAATGGACCTGGAACAGACCC
TTCGATTTTATTTTTTGTCGAATGATGGCTGGCAGCTTTTCTGATAACAAGAGCATCGTGCAGAAGGCTTTCAAGTACGC
CTGGTTACCACACATGTCCGATTTACCACAGAAACTGCAAAACTGACACTTGGTATTTCCAGTCACTTAGAACCCGGGGG
ATATTTTGAAGCTCAGGATATGAGGCTACCTCTCGAATGTGACGATGGAACCCTCAGAGAGGACTCAGATCTGTGGATCT
GGATGAGTCTGGTCATGGAGGCCATGGAAAATCTCGGTCGACCGGTCGTTGCTGCGCAGCAGTGGAAGCCATTTATGGAA
GAAGTCGGCTTTGAGGGTGTCGTCGAAGTAAACTACAAATGGCCCATCAACCGCTGGCCTCGCGATAGGAAATACAAGGA
GCTTGGCACCTGGAGTCTCGCCAACATGGACCAGGCCCTGGAGTCATCTACTTTGGCTCCGCTGACTCGCGGTCTCGGTT
GGTCCCGCGAGGAGGTTCTGGTACTCATCAGCAAGGCCCGTAAGGTCTTACGCGACACCAAAGTGCATGCCTACTGGCCA
ATGTGAGTGATCTCCCAACCTTGTCTTGTGATCTTCTCGAATTACCCTCTGCTCTCCCCTCCTTTCATGGCCCCATCTTC
TGACTTGAATCACAATAGGTGCATTGTCTATGGCCGTAAGCCCATGACTGCTAGTATTGACGAGAACCTTGGCCAATTCG
ATGTGGTGAACTCACCTACATCTCTACCCCCGTCTCCACTACTCCCCACAAGTCAGGATTACGAACCGATAGTACTCCCG
ACGTCCTCTTCAACTCACCAAGCGGGGGTGTATCCGTCCACTGCTCGAGAGTTGTCTCCCATGACAGAAGTACCTCTGTC
CCCGACAGATGCTATTTTGTCTCTTCCAACCTACTCTAGGCTCCGCTTTACGTCAGCTTTGACAGAGCCTTATGAATCAC
GTCCGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62