GenePrediction:GLEAN_8328 Details

Name: GLEAN_8328
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:2150968..2149721 (- strand)
Length: 1248
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:2150968..2150798 (- strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_97:2150401..2149721 (- strand)
Length: 681
>GLEAN_8328 class=GenePrediction position=GCSC_97:2150968..2149721 (- strand)
ATGGCACCTCATGCGGAGCACGATGACAACTGCGTTGCTAAACAATTGGCCGCGGGAGTTGAAGATGCCGGGCTTAACAC
AATCTTAATTACGAAGATTATAAATTGCGATGCCGAGGCAAGTGCCGAACTTTTCCGTGCCTGCAAAGATTTAGGCTTCT
TCTATCTCGACGTGCGAGACCACCTATCTCGAGAAGTCGCCAAGCAAATTAACTTAGTTACGTCTGCTGCCCATCAATTC
TACAACCTGCCGTAAGAGGAAAAGTCTACTTGGGAAGCTAACAAAGATTATGTGTCCGGAGAAGAAATTGTAGGCGGGTA
TAACATTGCCACTCTAGTATGATGATAGTGACAGATTCTGATATCCATTCTAGTTACAAGCCTGCTAGCATCCAGACTAG
CTTAGTTGCTGGTAAAGTCGATGGATTCGAAGGATTCTTGGTTAGTGATCATTAATTGCTATCTGAATGTTTATTTTTTT
TTTCTATTATTTATGTCACATTTCTCCTTATACAAGGAAAGAAATATGTTAAACTTGATCAACTAATATCCATCTCTTCT
ACTATAGATTTTTGAGCATGCCCTTCGAAATGCCGCCCGAGACAAGCCTGTCAACCTGCCTAAGGCCTTTCAAGAGAGAC
GTGAGCTATTCGAAGCCACTAACAAAAGTCTCGGCGATATTGGAAGGGTTCTCCTTGACAGTCTATCTCGGTCTCTCGAA
CTTGATGCCAAGGATAACCTCGCCCGACACCATCACCAGGACCATGCCTCTCCTACTGCCCTGGGATTGCTGAAATACCT
GCCTTACAATCCAGCTGCAGAAGAGGTTGGCCATGTATCGCACACTGATATTGGGAGTCTCTCTATGGTCTTCTCCGAAG
TCGGTGGACTCCAAGTCTACCACCCGGAAAGGAAGGCATGGGTGTTTATTCCACCAAAGCCCGGCCATACTGTGTGCAAT
ATTGGAGATTCGGTTGAGTTCCTGTCTAACAAGGCCCTCCGATCATCGCTCCACCGTGTCATTCCGCACCCTGCTGAGAA
GGGGAAGTCCAAGATGACGGTCGTCTACCTTATGAGGCCGGACACAGACACGGTTTTTATAGACCGTGAGGGAAAGAAGT
GGCGTAGTGTTGATTGGCACAACATGAAGAACAGGCTATTTACTGAAGATTTGGACTCCCAGGCCAGCAACCTTGCTTTG
ACTGGACGCTTAGGCCTGGACGATCTCTGGGACGAGAAGGAGGTTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62