GenePrediction:GLEAN_8329 Details

Name: GLEAN_8329
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_97:639144..640676 (+ strand)
Length: 1533
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_97:639144..639385 (+ strand)
Length: 242
Type: CDS
Source: GLEAN
Position: GCSC_97:639465..639621 (+ strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_97:639683..640356 (+ strand)
Length: 674
Type: CDS
Source: GLEAN
Position: GCSC_97:640421..640676 (+ strand)
Length: 256
>GLEAN_8329 class=GenePrediction position=GCSC_97:639144..640676 (+ strand)
ATGCGGGAGAGGACCGGCTTCTCTTGCATGGCATCTCGTCTTCGACCGTCTTGTCCGGTTTTGCTGACAAAAACTGCACA
GGTCTCACCGGAAGTACGAGGCGCCTCGCCACGGTTCGCTCGCTTACCTTCCCCGGTACGATTTTCTCCAGAAGACATCT
CTGCGCCATTGCTTCGAAGATCCAGGTCCACTGACAATTGGTATAGGAAGCGGAGTGCTAGCCACCGCGGTCGGGTCAAG
TCGTAAGTCCAGACAGAAGAACTTCCCGGGAGACACGACGCACAAAAGCGAAAAAGAGTCTGACCGATTTCTTCTACACA
GATTCCCCAAGGATGACCCGAAGAAGCCGGTCCACCTGACTGCTACGCTCGGCTACAAGGCCGGCATGACGACGATTGTC
CGCGACCTCGACCGTCCGGGTGCCAAGTCGCACAAGAAGGAGGTGGTGGAGGCTGTGACCATCGTGGATACCCCGCCTGT
GCGTACGACGCAGCCCGCTTGGCTTTCTGCTTGCCAATGGCTAACATCTTTTCTTCTAGATGATCGTCGTGGGCCTTGTC
GGCTACATCGAGACGCCGCGTGGCCTGCGCTCGCTCACCACTGTGTGGGCTGAGCACTTGGGCGACGAGCTCAAGCGCCG
GTTCTACAAGAACTGGTACAAGAGCAAGAAGAAGGCCTTTACCAAGTACGCCAAGAAGCACTCGGAGAGCAAGGGCGTGT
CGATCACGCGCGAGATTGAGCGGATCAAGAAGTACTGCACGGTTGTGCGCGTGCTGGCACACACCCAGATTCGCAAGACG
CCGCTGAAGCAGAAGAAGGCGCACTTGATGGAGATCCAGATCAACGGCGGCTCCACGGCCGACAAGGTCGAGTTCGGCCA
GGGCCTGTTCGAGAAGCCCTTCTCGGTCGACAGCATCTTCGAGCAGGACGAGGTCATCGACGTCATCGCCGTCACCAAGG
GCCACGGCTTCGAGGGTGTCACCGCCCGTTGGGGCACCAAGAAGCTACCGCGCAAGACCCACAAGGGTCTGCGCAAGGTC
GCCTGTATCGGTGCCTGGCACCCGGCCCACGTGCAGTGGACTGTTGCCCGTGCCGGTCAGCGCGGTTACCACCACCGGAC
GTCGGTTAACCACAAGATCTACCGCATCGGCAAGGGCGGTTCCGACGACAACGCGTCGACCGACCTTGACGTAACCAAGA
AGACCATCACTCCGTATGTGCCCGTCTGCCTCTGCCCTGTCTTGTGCCCGAAGAGTGGTCTGCTAACACACGTCCAGCCT
CGGTGGCTTCGTCCGGTATGGCGAGATCAACAACGACTTCGTCATGGTCAAGGGCTCCATCCCGGGTACCAAGAAGCGCG
TCGTCACCCTGCGCAAGTCTCTCTTCACGCACACGTCGAGAAAGGCGCTCGAGAAGGTCACGCTCAAGTGGATCGACACC
TCGTCCGAGTTCGGTCACGGTGCCTTCCAGACAAAACAGGAGAAGACCCAGTTCCAGGGCACGCTCAAGAAGGACCTCGA
GACCAGCGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62