GenePrediction:GLEAN_832 Details

Name: GLEAN_832
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:291640..292148 (+ strand)
Length: 509
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:291640..291700 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_132:291764..291892 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_132:292108..292148 (+ strand)
Length: 41
>GLEAN_832 class=GenePrediction position=GCSC_132:291640..292148 (+ strand)
ATGGAGATGGCAGGAAATTTGGGTGCGGTGAAGGGCCTTGGGGTCGTTGAGGAAGAGCCGCGTAAGCGAGATGCTCACAA
CGGTGTGATGGCCAGGCTGACTGTCGTCACAATGACGATGATAGTGCAGGCAAGTCGTCGGCTTAGTCAGCACTTACGAA
GCAGCTGGCCACACAAGCGCGTACGAAAGAGCTTCGGCAAGCGGGACAGTGAACATGGTGATCTAAGCGGTGTTGCCGGT
TGTATCTTTGTAGGTAAGTGACTGATGTGTACCATCTGGGAGTTTGAGAGAGTAGAACGCAAGACTCGGGGTCGCGTGAC
AACAAAGCCGGCGTAACAAACACCCATCACCAGGTACGGACCACGATTTCCGTGGTGATGTGCCTTTTCTTGCTAGTTCC
AGACATGTAGTTCGCTTCTCTGACTGACACACTGATCGGCTTTCCACTGGAATGTGGCCAATGTGTAGATACTTCGGTTG
CTTCGGCCGTCAATTTACCAGGAACGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62