GenePrediction:GLEAN_833 Details

Name: GLEAN_833
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:296023..296865 (+ strand)
Length: 843
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:296023..296067 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_132:296140..296865 (+ strand)
Length: 726
>GLEAN_833 class=GenePrediction position=GCSC_132:296023..296865 (+ strand)
ATGGGCCGCCCGTGTCCGAAGACCGCTTTTGTCATTCCCACAAAGGTGAGAAATCTCCCTGAAAAATCCCCCAACTATTT
TTCGTAGTCGTGTAATCACATAATGCCTGTGTCTTAGCTGCTCGAAGCATCACCGAACACGGATGCCCACATCCTTCGAC
TTCCGACCGAGCTCCTCCTCTCCTTCCTCTCCCTGATCAGCACTGAAGACAAGATATGTTTCGCCTTGACCTGCAAGCGA
ATTCTCCAAGCGTCCACCCTGCAGCCGTTCCTGATCCCATCTGTTGACAGGCATCGGAGTCTGGGCCCTTGCAGACATAT
GCAGGGCCTGCTGGCCCGAGTTAAGCCGCGGGATGCAAAGGGACGGAAGAAGAAGACAATTGCCATCTGCGCCTACTGTG
TGCGGTATCGGCCCAAGAAGCCGTCTTATTGGGAGAAGTTCTTTCGGGAGGGTGTCAGTGAAGCCCAGTGGACCGGGCAG
CTGGACTTGTGGAGCCGGCTGAAGATTGGCGAGTGCCCGGAGTGCTGGTATAAGCGGGCGATAGCACAGCTGCAACAGCT
CGCCGCCGAGAAGGTCGCTGCTGATATCGAGGCGCAGCTCGCCAGCGAGATCGCCGCCCAGAATGCGATAGCCACTCAGA
ACGGAGACCAGGCCCAGAATGACTCCGAGAGCGACGACAACATGGATGATATCTCCTTGTATACCACTTCTTCCGGATAC
GGTCCTTCCGAGTACGAGTCAACCAGATTTGATTCGGAAGAGGAGGAGCTGGGAGTGGAGGACTCCGAGGACTACTCTGA
CGAGGAGTCTTCCTCCAAGTCAGACGTGGACATGGAGATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62