GenePrediction:GLEAN_834 Details

Name: GLEAN_834
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:301542..303230 (+ strand)
Length: 1689
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:301542..302234 (+ strand)
Length: 693
Type: CDS
Source: GLEAN
Position: GCSC_132:302607..303230 (+ strand)
Length: 624
>GLEAN_834 class=GenePrediction position=GCSC_132:301542..303230 (+ strand)
ATGAAGTACGGTAGCGCAGCTGTTCTCTTCGCCGGCATGAGCCTTGCCTCGGCCGCCAGTCTGCCGACAGAGCGGACGCT
CAAGGCCCGTGAGGTGCCGCAGGAGCACTCGCACAACCGCTTCCTCGACCTCGTCCGGACGTCGCTGAGCACGAACAACC
CCAAGGGTATTTCCGACCCGGTCTTTGGCCTGCTCGGCAACGCCGCCGCGGCCGGAGGTGCTGGCAAGGTCACCAACCTC
GACTGCCTGCAGCAGGAGACGGCCGACCAGGCCTTTACCAACGCCAAGACGGCTGGCGACATTCCCGGTATGGCTGGTGC
CCTGCTGTACCGCTCGATCGAGCGCAACACCGGTGCCGTCGGCAAGGCCAGCGTCATCTGCAACGAGACTGCCACGAACC
CCGAGATCGCCGCTGTGTCGCAGCACCAGGACCCTGCGTCGTCTGGCGCCGCCGCTACCAACAAGGCCATCGTCCTGGCT
CTGGCCAAGCAGCTGGCAGCCATCGGTGCTGACCCGCTTCTCGCCCTCGAGAGCGGCACCTTTGCACCCGGCAGCCTGAG
CGACACCACCGCCAAGGGCAACTCCTGCGACACCGAGGCTGACGAGCCCGGCTGCATCTTCACCCAGAACCTGCTGGTCC
TCGACGCCTCCGAGGCTGAGATCAGCGCGGCCGTTGCCGGCATCAAGCCCACTGTCACCGGCACTGGTGCCATCAGCGCT
ACCGACATCAAGCTTGCCGGCCTCGCCGTCGCTACGGGTGCTGCTGCTGCTGATGCCACGTCTGCTGCTGCTGCCACTGC
TGCTGCCACCACGGCTGATGCTACGTCTGCTGCTGCTGCCGCCACTGTTGCTGCTGCTTCTTCTGATAGCGTCTGTGTCC
AGTCCACCGTCATGGTCACCATGACCGTGTCTGCCGGTGCTTCTGTGGCTGCTGCTGCCTCGTCTGCTTCGTGCAGCGTC
ATCACCACGACCGTTGCTGCCAACGCTGCCAGCTCCCTGGCCACCGTCACGACTGCTGCTTCCACTGCTGCCGCCTCTGG
TAGCGCCAGCGGTACCAACGTCCAGAAGTTCACCGGCACGCTCGGCGCTGCTGCCCCGGCCATCGAGTCCAGCGCGAGCT
CGCGTCCCTTCACCGTCAACGGCAACACGTTTGTGAACCTGGCCGCGGCTGTTCAGCGCTCTTGCGACGTTCAGCGCAAC
GCCTGCTTCAACGCGGCCAACTCTGGCAAGCTGACCGGCGGCACCGCCCAGTGCGACACCCAGGCCACCGCCTGCTCGGC
TGCCAACTCTGCCTCGGCCAAGATGCTCCGCCGTGCGTCCGACTTTGGTACTTGCAGCACTCCGACGATCCTGTTCAAGT
CTGGTCTTGACGGCCGTACCACCGATGCCTTCATCGCCTCCGACCAGACCGACTTCAACCACGGCTCGGCCCTGAACATT
GCCGTCATCGCCGGCTTCATCTGCCAGCGCCTCCAGTCGTCCTGCAACGCCGCTGCTAATGTGGTCTCGTCCTGCACCAG
CGCCTCGGCTGCTGCCGTCGCCACGACCCAGAACCAGGCTGCTGCGGATGTATTCAACAGCATGATCGGCGCCGGCTCAG
CTGCTGCAGCTACCACTACGGCTGCTGTCGTCGCTGCTGCCGCCACGGCCGCGGCCTCGCAGGTCCTGACCATCACCCAG
TGCGCATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62