GenePrediction:GLEAN_835 Details

Name: GLEAN_835
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:306995..309837 (+ strand)
Length: 2843
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:306995..307151 (+ strand)
Length: 157
Type: CDS
Source: GLEAN
Position: GCSC_132:307205..307314 (+ strand)
Length: 110
Type: CDS
Source: GLEAN
Position: GCSC_132:307394..307479 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_132:307638..307821 (+ strand)
Length: 184
Type: CDS
Source: GLEAN
Position: GCSC_132:307901..307986 (+ strand)
Length: 86
Type: CDS
Source: GLEAN
Position: GCSC_132:308089..308171 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_132:308239..308344 (+ strand)
Length: 106
Type: CDS
Source: GLEAN
Position: GCSC_132:308409..308510 (+ strand)
Length: 102
Type: CDS
Source: GLEAN
Position: GCSC_132:308841..308994 (+ strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_132:309135..309338 (+ strand)
Length: 204
Type: CDS
Source: GLEAN
Position: GCSC_132:309457..309837 (+ strand)
Length: 381
>GLEAN_835 class=GenePrediction position=GCSC_132:306995..309837 (+ strand)
ATGTCGTCTTCAGAACGCAAGCCTCTGGCCTATTCGGGCACGCTTGACTCCTACGAGTCGTTTGATGTTACGCCGACTAT
CGGACGGGAGTTTTCTCATCTCCAGCTCTGCAGCTTGCTGTCTGATGATGCCAAAATCCGCGACCTCGCTGTTTTGGGTG
AGTACAGCGGTCCTTGTGGTTCAGGCCAATATGTGTTGACTTCTAGACAGTATCGCAGCGTGGCGTGGTATTCTTCCGCA
ACCAGGACCTGAAGCCGTTTGACCAGAGGGAGGTTGTGCAGAAGCTCGGCCAGTTGTCGGGCAAACCGCAGACGTCAAAG
GTTGGCCGCTTTAGGCCAAACACTAGTATCAAGATAAATTACCGGCTAACTCTTTCAGATTCATCGCCACGCATCCTAGG
GAAAAGCTGCAGAGGCGGCTGGCAAGACACTTCCGGATGGAGAGCCTAAGCCCGACGAAGTGCTGGTGATCACGTCGGAA
GTACTGTACCCTAAGGGACGCAAAATGGAGCAAGGCTGACCGATCTGGACAGAATGCCAAGGGTCTGCAGCATAAGGCTC
ACGGATCGGAGCTGAAGCCTCTGGCTAGCACGTTGTGGCATGCCGAGTATGGCTTTCTGTCCCGATTCCGAAATGAGATG
CAGAGCCCTGGTTAACAAGGACAGCATCACGTTTGAGAACGTCCCGTCGGACTATGCCATCCTGAAGATGAACATTGCCC
CCGAGACGGGCGGAGACACCATCTGGGCTTCAGGGTACGAGGCGTACGACCGTCTGTCGCCGGCCTGGAAGAAGCTCGCC
GAGGGTCTGACAGCGACTCACCGCAATGTACGTCTTTCTGACTCTTTCTTTTTTTCTTCTTTTTTGTCTCGGCCCACTGC
TGACGGCCCCCAAGCTCTCACTCAAGCGAGCAGCCGCAGAAGTGGATGCACAGTATATCGGAGAAAACCGCGGCTCGCCC
GAGAACGCTGGCCTTGACTTTGAAGCGACGCAGTAGGTCTCTAACAAAAACCAAGTAATTAACAGGCGGTAAACGAGCTA
AATTCTGACCGGCAGTCCCGTGGTTCGAACCAACCCAGTGACCGGCTGAAAGAGCCTGATGGCAGCCGGCCACCAGCTGC
ACGACGGTGAATTCATCGGCCTGACGCCGCGTGAGGACGAGATCCTCAAGGCCTATTGTGAGTGCAGCTCTCCAGAGGAC
TTTGGTCGAATATTTGTCGTGCTAAGCGATGCCAACCCATGCAGTCCTCCAGATCGTGGTCGAGAACCATGACCTGCAGG
TCCGGTTCAAGTGGAACACAAACGACATTGCCATCTGGGACAATCGGTCGTGCTTTCACACCGCCACCTTGTAAGTCTTC
GCTCAGTATCTCAATCTTTCTGCAGACAGCGTCCCTAGCGGCTGACGCCATCAGTGACTACGCCACCAAGCGAGAGGGCT
CGCGCTACGTCTCCATTGGGGAGAAGCCGTACCTGGATCCGCGCTTGCCATCGCGTCGTGAGGCCCTGTCGAGGCTGTAA
GTGGTGGAGGCAAGCGGGAGGATGGGGTCTTGGCTATACTAGTGTTAGTGGAAATGGCTCCTTCTGCGGGAATAACAATA
ATCTGGAGAGTCTCCTCGTTCGTGATTGTAGCGTGTAGCAGATCATATCTGAACGGAAAACAACCCCTTTTAGTCCACGT
TTAGGCTTCCGTCGCCTAGCACGTTATATTGACATAAGCGAGATCGGGGGGGTCGTCTGTGACGCGGTTAGTCTACAAGT
AGCAGTGATAGTTACAGTCTGCAACTATGCCGCCCTAGTTTAATATAGAGATGTATCTATCCGCACGGACAATTATAACT
CTATAGCATCTTCGCAATGGCACCCGAAGCAACAGAAAGCGTGCCGGTGGCGTCTAAAGGCTCCCGGCTGGCACCACTAA
AGCTCGGTAGCGTTTTGGACCAGTTCTATTCTAGAGAGTTGACGCCTGTTATTGGTACTAAGTTCTACAACGTTGATCTG
GTAGACTGGCTGAACGCGCCTAATTCGGACGAGTTGCTGCGTAACCTGGCTATAACAAGTGGGTTCTCCCTTCTCTTTGC
TTATTTCCTCTGCTTACACCCACAGTCTCCCGCCGCAACGTCGTTGTCTTCCGCTAACAGGGCAGCCTCGACAACAACCT
GCAAAAGGTGCTGGTGCAGCGGCTCGGCGAGCTCGTTAGAAAGCCCGGCACGTCGAAGCTGCACATCCACCCGACCGTCA
ACATTGGCCGCGACGCAGCGGGCGTGGCTAAGGACAAGGAGATTAGCGTGATTGACTCGACGCGCGGCCGCATCATCTTT
CGCGGCGTGCAGGACCGCGAGACGGTCAAGGCAAGCAACACGGACACTCTCCAGATTATTGTTATTACCGCAGAAGGAGC
CATTTCCACTAACACTAGTATAGCCAAGACCCCATCCTCCCGCTCGCCTCCACCACTTACAGCCTCGACAGGGCCTCACG
ACGCGATGGCAAGTCGTCGCCCGCTTCCTGGCCAGTCACATCCAGCTGCCTCCTTTGGACAGCCAGAAGAAGTGGGAGAT
CGACCGGCTCGCCCGTGTCGGCGATGGACAGCCCTTTTTCAAGGTAGCCCCGTACTTTGAGGAGTACTTTGAAGCTCTCC
GCGAACTGGCCGGCGAACCGGTTCCTGGCACCAAAGGCCGCCGTCTACCTAAGTGGAATCCCGCCTGGCTGGACGTGGCC
GACCAAACGATGGAAAAGAGAATTGCACGGTGGCGGGCCACCGCTCTGTTTGACGCCCGGCAGCTGGCTGAGGATGAGGC
CCAGGAGAATCACAAGGAACGTGAAGGCCAGGCTCGGCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62