GenePrediction:GLEAN_836 Details

Name: GLEAN_836
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:313185..313927 (+ strand)
Length: 743
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:313185..313352 (+ strand)
Length: 168
Type: CDS
Source: GLEAN
Position: GCSC_132:313658..313927 (+ strand)
Length: 270
>GLEAN_836 class=GenePrediction position=GCSC_132:313185..313927 (+ strand)
ATGTACGACGTACTCCCATCTGTCGGCATAGATCAGTCACGGCTAGAGATCATTAGGGTAAAGCCCATTAGGGTTGGCCT
TGCTGCACTTCACACGCTGTTTGACTCGGTCCGTAAAGACAGAGCGACCCCATGCACTCCAGACGCACTGGACCAGCTTG
ACCTAAAGGTATGGCCGTTTAGCCTCGCTGCATCGTTATCGTTTAATCAGCCTACAGTTGTCCAAGAAGTGGTACTTGTC
TCTCTACCAGCGGCGCAGAACCTCCTGGCGACCCGACTTCTACCCGTTAGCACAGGATCTCGCGATTCGAACTGTTACTC
AAAGCAAACGACGTTGACCTCAATCGCATGAAAAAAATGCTGAAAATAGTCCTCGCCGATAATCCAGACGATGCCGCTAT
CTCGCACAAAATATACAAAGCCGTTGCTGAATCTACGTTACCTCCACGAAAGTTAGCGGCATCCCTCTTACAGACGTCCT
GGCTGCACAAATCGAGCAACTTCGTCAACTCCCCCGAGTACCGTCATGACGTAGACAGGGTTTCTGAGTGGGAATTTGGT
CCTCTTTATGTCGGGTTCGGTCTTCATGAAGATCTTTGGGAGGTGCGACAGGGCTCAAAGCCACGTCCGAAAGCGTCTTT
ACCAAGTGCCTCGAAGGCGACTAGAAATGTGGTATTCCACAAGGACAAGGCGTGGAAGCAAGAAGATGAGACGCTCTACG
ATCGGATGCGGAAAGTTATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62