GenePrediction:GLEAN_837 Details

Name: GLEAN_837
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:316659..318455 (+ strand)
Length: 1797
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:316659..316670 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_132:316740..317544 (+ strand)
Length: 805
Type: CDS
Source: GLEAN
Position: GCSC_132:317605..318455 (+ strand)
Length: 851
>GLEAN_837 class=GenePrediction position=GCSC_132:316659..318455 (+ strand)
ATGGAATCCGTCGTGAGTTTTAGTCATCCATAGCCATCATCATGACACTAACCGGCCAGCGTGACTGACCGGCGGCTGCA
GACACGGCCGTCGCCGTTCCGCTTCGACCCGGATCAGCCATGGTGCCGAACGCGGTACCCACTCACGTTTGTGGATGAGA
ACCGGGAGATGCTCTCGCTGTACGCCGAGCTTCCGGACGTGGACTACGATGAGAAGGGCAACACGCCGAGCAGCGAGTCG
GACAATAAGGGGGGTGATGATGCTGTTGATGATGTTGCTGATGAATATTCTCTGGAGGCTGCCACTGATGCCACGGCTGT
CAACCATATGGTGACGCCTTCGCTAACGGAACAGGATTGGTCATCGATCGACATAGTCTGCAGCCCAGCCAACTACGGCG
AGCCAGATCGGAGCTCCAGCGATCTCTTTTCCCCGTCGGGTCATGCGACATCGCTCCGTCACAACAGCATTGGCATCAGC
GACCTCGTCAACTCGCCCGAGCACAACGACCCGTCCTTGTCGCCCTTGTCGCCCTGGTCCCCTCCCTCGCTCCTGGCCTG
GCCGCTCGAAAACGCCATGGAGGCTGGCCTGTTCCGGCACTTTATCGACATTGCAGCGCGGTCGTTTGACCTCTGCGACC
TCGAGCGCAGCTTCGCCGTGGTGGTGCCGTGGCGGGCGATGGAGCACGCACCGCTCAAGAACGCCATGTTTGCGATCAGC
GCGAAACAGCTCAGTCTGACCAGTGCGTTTGACAAGAACGTGTCGGACCGGTACTACCAGCGGTGTCTGGCAACGCTGCG
GCCAATGCTCAACGACGAGGCCGCGCTGGTGGACGAGAACCTGTTTGCGGCAACGGTGATTCTGCGGAATCTGGAAGAAA
TTGAAGGTTCGTTTTCGATCAATCTTGTTGCCAAGCGTTGCTCAAACTCACTCCAAACTCGAACAGTTCCCCTTGCGGGC
GCCGACACCAACACCTACCTTCTCGGCAACAGCCTCTTTGTCAAGGCCTCGGCCGTGCTGCACGACTCTGCCGGCACGTC
AGCCCCCATCCTCTTTTCCGGGCTGCGCCGGGCTGCCTTCCTCGTCGCCGTCCGCCAGGAGATCTACACTGCCTTTGTGT
CGCAGCGGTCGATCGACCCATCCTTTAGCCCGTTTGTCGTCGACATGGCTTTAGACCTGGAGGGCGACGATTTTGACTGG
GCTAACCGGGCCGTCTTTTTGCTGGCCGATGTACTGCGCTTCTGCTACGACAAGACGTCAATGTCGACCGACGACACAAC
GGCCTGGCACGACCGTCTCTCCATGTACAGCCAGCTCTGGTACGAGAAGAAGCCGTCGAGCCTGTCGCCGTTCTACTGTG
GAGGGGGTGCTGATGGTTTTGATGCTGCTGACGGCACTAACACGAACACCACCACAACTACATCTCCCTTCCCTGAAGTC
TGGCTTATGTCAGACGCCGCGGCCACCGGATTGCAGCACTACCACCTATCGCGCATTCTTCTGTATGCCTTTGACCCACG
GGCGCCGCGCATTGGGCCCGGCCGGGCGACCTTTGCTCGGCAGCAGGACCAAGCCATCCGCCAGCAGGTACGGCTTCTAG
TCGGCATCGCCAAAAGTAACCCGCACTGTCGGCCCAACTACGTGTCGGCGTGCATGGGCATCACCGTGGCCGGGGACCGG
TTTGAGGACCGGCGCGAGCAGGAGGCTATCATGGATTTTCTGCAGGAGACTGAGGAAATTTGTGCTTGGCCGACCGGGAC
GGCGAGCAAGCATCTTTCAAGGGCGTGGGGGTGGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62