GenePrediction:GLEAN_839 Details

Name: GLEAN_839
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:323337..324470 (+ strand)
Length: 1134
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:323337..323923 (+ strand)
Length: 587
Type: CDS
Source: GLEAN
Position: GCSC_132:324159..324234 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_132:324282..324470 (+ strand)
Length: 189
>GLEAN_839 class=GenePrediction position=GCSC_132:323337..324470 (+ strand)
ATGGCTATTATTCCTAATAATGAAGACTTTGTCCGCCCTCCACCAATAGAGCCGACCTCTATCATCCGCGTTGTTTCGCC
GGCCGGAGCAGTCAAGGAAAGTGCACTGAAAGCCGGAAGAGAGTACCTGGAAACGGCCGGGTACCAGGTAAACCAGCCTG
AGACAGTCACGGAGCGCTACAACTATTTCGCCGGAAACGCAGCATCACGCGCACAGGAGCTGCATAAGGCTGTCTTGCTA
GCAAAGGGCCATGAGAGCATCATATGGGCCGCCAGAGGGGGCTACGGATCGTCGCAAATGGCAGAGTACGGATTAACCGT
GGAAATGCTGCACGACCTGCACCAGGAGTTGACGCAGAATCCGAAATGGCTTGTGGGCTACTCCGACATCACCTCCATCA
GCCTGCACTTGTGGGCAAGAGCGAGAGTCCTGGTTCTACACGGCCCCATGGTGGTCAACATTACCGAATACAGTCCCGAA
GCCGTAGAAGAGACGTGGAAAATACTGAAAGGAAGCGAGCCACTCACGCAGGTCTTTACGGGGAACATTCGCTATGGAAA
GGGCCAAGGCTTGCTTGCAAACGGCAGGTTATTGGGTGGTAACCTAGAGGTCATTGCATCGATGCTAGGAGCCAAGGACC
AGGAAGGGCAAGCGCTAATCCCGTCTTTAAACGGGTGTATCTTGCTGCTGGAGGAAGTAAATGAAGCACCATGTGAGCTT
CCTTGCTTTTGAGGCTCTCAGTATGCACTGTCCGTATGTTGACCGCCTGTCAGATCGCATACATCGTGCGCTTTCAGCTC
TGCTTCGGACTCCCTACCTCAGGTCCCTGGCTGGAATAGCATTTGGTCAGATGACAATGCCCGATGGCTATGCCTCTGAC
GAGTATGGCGCGTACGACGTGAGTCCACTCCCTATTCTCCCTACTTTAATGCAGGCTTCTCACAGGTCCTCCTTGTGCCA
AAGGTTCTTCACGAGCTGTTGGAACCTCTGGGCATTCCCATCATCACTGACGTGGATATCGGTCACGATACGCGAACCGC
TCGACCAATCGTGCTTGGTGCACAAGCAGAGATTCACGGAAATGGGGTTTTGAAAGTGCTCGTTCCTGGCTGTTACGATG
GAGTGAAAATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62