GenePrediction:GLEAN_83 Details

Name: GLEAN_83
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_179:533158..534765 (+ strand)
Length: 1608
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_179:533158..533229 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_179:533299..533541 (+ strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_179:533606..533637 (+ strand)
Length: 32
Type: CDS
Source: GLEAN
Position: GCSC_179:533694..533721 (+ strand)
Length: 28
Type: CDS
Source: GLEAN
Position: GCSC_179:533794..533801 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_179:533879..534006 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_179:534058..534228 (+ strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_179:534281..534765 (+ strand)
Length: 485
>GLEAN_83 class=GenePrediction position=GCSC_179:533158..534765 (+ strand)
ATGGCTGCCCAATTCGCAGTCCAGCCTGCAAACCGGTTCAGTGGCCAGAGCCAGCCCGTGAAACGGCCAAAGGCAAGAAG
CGCGCGCGGAGACCGGGCTGTCCTCATCGTTGCGCCGGCCGAGAGAGACTAACACGCCCAGGAATTCACGTGCTTCTCGT
ACGACGACAACCATGAGCTCCATCTGGACGATCGGTCGCTGCGCTGGTACTATCCGCCGTTGCTCAATGCAGACCTGTCG
CGCGGCTTTGACCAGTTTGACAAGCACGACGACTCGGCCGACGAGCACCTGGACAGCCTGCTCAAGGCGATCGCTGCGCA
CGAGCAGAAGACCGGCGTCAAGACTGACGCACAGGTCGTGACGTGGCGCGGCATGATGACCAAGGTCTTGTCTCCTGTGG
ACAGATGGACGGGACGAGACCGGCCAGCCTTTACTGACGCCGTGGCAGATCATGGCAGCACCGTTTGATGACCGAGACGG
GTAAGATCCACAGTGTCTGCTGTTGGGCTGTGATCTGAACTGACGTGTGCGGCCAGGTTCGAGATGAACGCGACCCTGTA
TCAGGTTTGTCCTGCCCATACGAGAGATGCATGTGTGTATAGCCGCCCTAACCATACGCCGGCTTTCTGAGAGCAGGGCT
GCATGTACGTCTGCTTCTACCAGGACCCATCTCGTCCTCTGTCGTGTCTCTCCTGACCCCACCTTCCTTCTGCGGCTACA
GATTCATCGAAGAGAACCATGCCTATAAGGCGGCATCACGACGAGAGCAAGAAGCGCGCCAGAATAGGCGGCCACCACGA
GCGAATCCGAACCAGCCGTGGTTCCCGCCCGACGTCATGTCCTTTTGGGGTCTGTCGTCTTGCTGCTGTTGTCTATCTGC
CCCTGACTGACGCCCGACAGGCTACAAATTCGAGACCCTGGCCACGATTCCTACTCCCTGGGGCGAGACTAGCCGTGACT
ATATCGAGAGCCGCGATGATCTCCGCGTCAGCAACAAGGCCGAGTACTGCTCTGTCGTGCGCACCGGCGTCGGCTCGACC
GTCTTGTGTCTTGGAGGCGAGGTGGATGCGGGTGCGTGCTGTCGACCCATTCCCTTTCCCTGAACTGACCTGACATCCTC
CAGTCTGGGACTCCAAGCCGGAAAAGGACGGCGCGCCCATCCGCTGGGTCGAGCTCAAGACCAGCCAGGACATCCTCACC
GACCGCGACATGAAGGCCTTTGAGCGCAAGCTGCTCAAGTTCTGGATCCAGTCCTTCCTGCTCGGCGTGCCCAAGATCGT
CGTCGGCTTCCGCGACCGCGCCGGCCGTCTGCGCCGGCTCGAGGAGATCGAGACCACCACCATCCCCGACACCATCCGCG
CCCGTGGCCACGCCGCCTGGGACGGCAACACCTGCATCAACTTTGCCGCCGCCTTTCTGGCCTGGCTGCCCACCGCCATG
TGCACCGGTGATGGCGACGGCGACGGTGTCTGGCGCATCCGCCGACGGCCTGGCGCTCCGAGAATTGAGGTCTTCCGCGT
CGAGGAGACCGGCCACGGCCGTATCCTGCCCGACGACTTTCTCAACTGGCGCATCAAGCTGGCACTCAGTGGCACCGGCA
CTGCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62