GenePrediction:GLEAN_840 Details

Name: GLEAN_840
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:327620..329051 (+ strand)
Length: 1432
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:327620..327726 (+ strand)
Length: 107
Type: CDS
Source: GLEAN
Position: GCSC_132:327786..328635 (+ strand)
Length: 850
Type: CDS
Source: GLEAN
Position: GCSC_132:328692..329051 (+ strand)
Length: 360
>GLEAN_840 class=GenePrediction position=GCSC_132:327620..329051 (+ strand)
ATGCGTTTCACCACCGCCCTCACTGCTGGCCTTATGGCCAGCTCTGCCGCCGCAAAGCCGCTGAACGTCATCAAGGCCAC
CGAGTCTTTGATCGACTCGCTCAAGGAGTATGCAGATCATTTCTCCTGTCCCCCAGATTCCCCCGCACCCCTTCTAACGA
TCACAGGGATGTCATCAGCTGGGCCGAATACGTCGAGTCCGAGGTCAAGAACCTGACCTCGAAGCCGGCCACCTACAGCC
GCACCAACCTCTGGTCGACGCCACCGTCAAATGAGTACCTCAACTGGACGACGTTCAAGGCCAACGGTGTCAACCTGGGC
AACTGGCTGCTACTGGAGTACTCGAGCGACCAGACCTGGTGGAACGAGCAGGTCCCGTCGACGGTCGAGAAGGACGAGTG
GAGCTTCTGCGAGTACCTCGGCTCCAAGTGCGGCCCTCTCCTGGAGAAGCACTACGCCAGCTACTATAAGTTTGCCGACA
TCGACAAGCTGGCCAAGGTCGGCGTGAACCTTCTGCGGGTCCCTATGACGTACCAGGCCTGGGTCGACGTGCCGGGCTCG
CAGCTGTACCACGGCTCGCAGCTTTTCTGGTTCAAGCTGATCACCGACTACGCCATTGAGCGCTACGGCATGCACATTGT
CATCGACCTGCACTCTCTCCCCGGCGGCTGCAACGGTCTGGACAACGGTGAGGCCCTCGGCCACTACAATTGGTGGTTCA
ACCAGACCAACATGGACTACACCCTCCAGATGGTTGAGAAGGCTATCAACTACATCGAGCTCAGCGGCCACCCCCACGCC
TACTCGCTCTCGCTCATCAACGAGGCCATCACGGACTACGACAAGATTGGCACCAACGAGACCGTCTCCACTGCCGGTGT
TGATTACATGCTCACGTACCTGAACTCGTCTCTGGAGATCATCCACAAGGTCAACAAGAACGTGCCGATCATGTGGCAGG
ACAGCTGGATGGGCGAGGAGTTCTGGTCTTCTCTGCTTCCCACCGATGCCAACATTGTAAGATATATACGCCCCATCCTT
GTGCAATTGTCTTGACCGAGCTAACCGTTCAGGTTCTGGACCTGCACATCTACTTCTTTAGCAACCTGTTCTCGGATGCT
TACTCCAAGTACTTCACCTACTCGGTCTGCGGTGCCGGGGACTACTTTGCTGGTGACAAGAAGATCCCCGTCTTTGTCGG
CGAGTGGAGCGATGAGATCCTGTACAACAACTCTCTCGCCGACCGCAAGACCAACTTTGACACTCAGCGGTATGCCTACG
CCCTGTGGGGCTCCGGCAGTGCCTTCTGGAGCGGCAAGCAGTACGGTGTCGAGAACGTGAGCGGCGAGGGCATCCGCAGC
GACTACTGGTGCTACGAGTGCATGCTCGAGGACGGTGTCATCACTACGGCCACTACTGAGTCTTACTGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62