GenePrediction:GLEAN_842 Details

Name: GLEAN_842
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:335705..337011 (+ strand)
Length: 1307
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:335705..336527 (+ strand)
Length: 823
Type: CDS
Source: GLEAN
Position: GCSC_132:336587..337011 (+ strand)
Length: 425
>GLEAN_842 class=GenePrediction position=GCSC_132:335705..337011 (+ strand)
ATGCCTCTCCCACAGAATACCGTCGCTGCCCTTACGGCACTGGTCGACAAGGCCGTGGCCAACCCCACGACCGACATTCC
TGGCGTGGCTGTCGTAGTGGTCGACCGTAATGGCAACGAGTTGTTTACCCGCGCCGCTGGCCGCCGCGGCGTGACGACGA
CTGAGCTGCTGACGCTCGATAATGTCTTTTGGATTGCCTCGTGCACCAAGATGATTACGGGCGTGGCCGTCATGCAGTTG
GTCGAAAAGGGCGTGCTGCGGATGGACGACAGCAGTCAGGTGGCCAAGCTATGTCCCGAGCTGACTGGCCTGACCGTTCT
GCTGCCTGACGGCACGACGGAGCCGCAGAAAAATGCCATCACGCTGCGCATGCTGCTCACCCACACCGCCGGATTTGGCT
ACAGCTTCTTCAACGAGCGGCTGCGTGACTGGTGGCTGCCCATCGGCGCCAACGAGTTCTCCGGCCGGATCGAGGATATG
CGCATGCCGCTGCTCTTCCAACCTGGCGAAGGCTGGGAATACGGCGTCAACATCGACTGGGCCGGCGTCCTGCTGGAGCG
GGCAACCGGCCTCACACTCAACCAGTACCTGCAGAAGAACGTGGTCGGGCCGCTGGGACTGACGGACATCAACATCATCC
CCTCGGTCGACATGCGCGCCCGTCTCGCCCACATGCACTTCCGCCAGCCCGATGGGAAGTTGCGCGTCCGAGACCATCCG
TTCCGGGTGCCTCTGGAGGCAGACCCTGATGATGCGGCCGCTGTGGCCCGTGTGTTTAATAGCGGAGGTGCAGGCGTATT
TGCCAGGCCGCAGGAATATACTAGTAAGTTAGATCACCTCGTCCCTCTTCACATCCAAGCATACCCATGCTTACACATAC
AGAGATCCTCGCCGTCCTGCTCAATGACGGAACCTGTCCTCGCACTGGTGTTAAGCTCCTCGAGAAAGAGACGGTGAACA
CCATGTTCACCAATCAGATCCCCCAGTTTCCCAACGCCGGGCGGCAATTTATCCCGGCTGCCAAGCCCGAATACACCAAC
CCGATACCGGAGCTCTACTCTGTCCCGGGGAGCCCGCCACAGGGATGGGGCCTGACCTTTATGCTCAGCAACGGTGGCGC
GACGGGACGGTCTAAGTCTACGGGACATTGGGCTGGCCTGCCAAACCTCTGGTGGTGGGCCGATCGTGAGAACGGCGTTG
CCGGCGTTGTCTTTACGCAGATTCTCCCCTTTGTCGACAACAAGGTGCTCGAGCTGTGGGCAAATGTCGAGACCGAAGTG
TACAAAGCGTTAGCCAGTAGGGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62