GenePrediction:GLEAN_843 Details

Name: GLEAN_843
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:337690..340935 (+ strand)
Length: 3246
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:337690..337801 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_132:337862..338109 (+ strand)
Length: 248
Type: CDS
Source: GLEAN
Position: GCSC_132:338284..340662 (+ strand)
Length: 2379
Type: CDS
Source: GLEAN
Position: GCSC_132:340831..340935 (+ strand)
Length: 105
>GLEAN_843 class=GenePrediction position=GCSC_132:337690..340935 (+ strand)
ATGCGACGGCAGAACCGGTCGTGCGACCAGTGTCGCAAGGCGAAGCGAGCCTGCGACGCGCCGTCGCTGCAGGGAAATGG
CCCGATCGCCGCTGCGGACGGTGATGCACTAGGTAACGAAAACTGTGTTTGGGCGACGTTGCCCAACTGGCTTTATGCTG
ACAACTTTCCAGGCGAAGAATGTCTACCGTGCTCCTATTGCGTGCGGACAAACAAGCGCTGCACGCTCAATTGGGCACGG
ACCCAGCGACAGGTCGCCGAAGCTGCCTTGGCTGCCCGAGCGCCAGAGCTGCACCGTCCCAAACGAAAGCGCACAGCTTC
AACGGATGTTCATCTGAATGCTGTTCGGCTCGTCGTTTCGTCTGTGTCTGCGCCGCCTCTGGCAGAAGCATGTGATAGCT
TTCAAGACGGCGATGCTGATGTCTGTGAGACTTCTAGAACGGCAAAACGTGCTGCCTGTCCTGACGATTGTCTTTCTCCT
CTTGCTCCTCTTCCTGTTCCTGCTACGATTCCACTTCTTGTCCCTCTACATGTTCAACTACCCACCCCACTGCCTCCTCC
TCCACCTACTCCTGCCCATCCGTTCACCTTCCAGCCATTGTCATCACTGAATCTCCACGCCGGCATGCCATACTGGGCGA
CCGACCACCCGTTCCTAGCCTTTCGAGACACATCCATGGCAGTCATGGACAGCAACACGCCCCTGATGTCTCTTCCCACC
TGGAACATGCCGTTCAACATGCCACTGCAACCGCACTTTGATCCCATCGTCCCGCAGCCTGTGCTGGATGATGCTGCCAT
GTGGTCGATCCCGATGCTGCTGCAGACTATGCAGACGGCCGCCAGCCAGCAGTCGTTCGTGAACGTGAGCGCCGCCTCGT
CACAAGCGACAGCAACGTCGTCAGTAGCAGCCAGCTCGGAGTCCGAGCCAGACAGACGTCGATCATCCAGCGCGACGTCT
GCCGTCTCATCCTCGTCACTTGAGCAGCTACTGGCAACGCGAGCCAATGGTCGGGCCATCTCGGCGAACCTGCTGCAGAT
TTACCACGACGTGCTGGAGCACAACTTTTCTTGCTGGATCACTGAGGCCACCTGTCCGTACAAGGGCTGGAGACGGGAGG
GGGTCCGGGGATCCGCCAGCAGCAGCAGAAGCAGCAACAGACAACAGACAGTGGTGGGCCGACCGCGGCCGCAGGAGCTG
GGTCCGCAGTGGTCGAACCGAATCTACCTGCGGGTCAAGCAGCTGGACCAGATGGCCGAAGCGGCTGGCCTGATCGACAT
CACGGCCAAGCAGAGCCAGGCCAGCCAGCGGGCCCTCGACTTGGTTATCATGGCCTTTGCCACGCAGTGGGCACAGGGAA
GCAGCCGCCAGCGGGAGGCGTATGCGGCCAACTTTGCCGTGGCGGCCGAGCAGGGCGACGCGGCCAACCTCACGCCCGAC
GAGTTTGACCGTCACCTGCAGAGGACATTGTGGGAACAGGCACGCCAGGCGCTGCAGGCATCGGCCGACGTGGAGTCGTA
CCGCATGGTGTGTGCCGAGCTGATCTTTGGCTTTGTGCAGCGACCGTGGAGTGAGACAGACGTGTCCGCGATGCTGGGAT
TTGGTTGCGGTGTTGATGCTGGCAGCCATCCTGCCCGCCCTACTGCCCCCCCTCTATTCCCCTCCCGGACACACTTCTTG
GCCAGGCTCGAAGACGTGCTGGCGCGAGATGGGCCGCCCATCTTCACCGAGCGGGCGGCCCGCAAGATGCACAGCCTCAA
GTACCGGTTCGACCGCCACGAGGCCCGCGGCCGGTCTCGCGTCGCTGCCAAAGACAGGGCTACTGTCGGGCTGCTATACT
GGCTGGCCGTCATGATCGACACGATCCAGGCATCGGTGCACGAGCGCCCGGTCGTGCTGGCGGACGAGGACAGCCAGCAC
GACGCGGCCAAGGAGGATGACGAGGAGGATGGGGAAGACGAGTACGAGGATGAGGTACTGGACGACCTCTCCTCGGGGTC
GTCGCAGTCGTCCGAGGGGCGTTTTGTCACCAGTGTTGGCAACCAGGACGGCAGCAACAACTGCGGCTTCCCTATCAGCA
CCGGCCTCGGCACCGGTCTCGGCAACTCGGGATTTGTCAGCAATGGCACGTGCCTCGGCAACTCGGGCTTTGTCAGCACC
ACTCCCAACCATAGCCGCTGGCGCATCGACCTCTTCATTCAGGACAACCCCGAGTGCCAGCCGGCCAAGCGACAGCGGTG
GCCGTGCTCGTACGATGACGCCAGCCTGACGATTGCGCGCTCGGCCCCGGTCAAGGTGCTGCTGTACCGCTATGTGCACT
ACCTGCAGAAGCTGCTGCGATCGCGACGGCACGTCCGACGGGCGCCCGAGCGCACGACAGCCGCCACGCGGGCTGCGGTC
GCCGTCGAGGACACGGTACGGGAGACCCTCCTGGTGTACCGGTACTGGGACGAGACGTACGGGGCCTTTTACCGCGACGT
GGTGCAGCATTACGGCTCGGTGCCATCGCGCATCCGCGGCTGGTCCGTCTGCATCGCTGCTCACTGGCATCTGGCTGCCA
TCATGCTGGCCGACGTATTGGAGGAGCTGGATGGCCGCGGCTATGGCATCGAGGCTGCTCGCGCCGTCCGCCAGGTGGCC
AACACGGTCGCGACCATGCGGCGGTCCAGCGCAGTGCAGCTCTCGGATCTCGCCCGCATGGCCACGCCTTTCGGATTTGC
CCCCGAGATCAGTAATTTCAGTCCTGAGCTCGTGCCGGGCTTCTCTCCTGGCTTCGCGGCCGGCTTCGCCCCCGACTGCT
CGCCCAACTTCGCTCCCAGCTGCCCGCCCGACAGCTGTGCAGCCCCCGACTTCCACTTTGCCGTTCTCGAGGGCACGATC
TTGACGGAGCCCTGGTCGATGCTGCTGATCCAGGCGTTCTCGCGGGCTGGAATCCTGCTGCTGCGGGAGTACGACGGGCA
TCAGCCCCGATTCGTGCAGACGTCGCAGCCGAAGCAGCGGGAGCCCTCGGGACATCGGCCGCAACAGCCGGGGCAGCGGC
AACGACAGCCGCCGCAGCGACAACAGGTCGGCCGGCAGAAGGAGAAGCAGGATCGACAGCGGCATGGACACGGACCGACG
GAGCGGCGCGACGGCGTGCAGCGGTGCGAAGACTGCGTGCGGGCGTTGTGGCTGTTGGGCAAGAAGTCGGACATGGCGCG
CACAGCGGCCACGGTGCTTTCCAGGGCAATGCGGGTGGATGTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62