GenePrediction:GLEAN_844 Details

Name: GLEAN_844
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_132:343940..346624 (+ strand)
Length: 2685
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_132:343940..343973 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_132:344037..344048 (+ strand)
Length: 12
Type: CDS
Source: GLEAN
Position: GCSC_132:344162..344220 (+ strand)
Length: 59
Type: CDS
Source: GLEAN
Position: GCSC_132:344288..344420 (+ strand)
Length: 133
Type: CDS
Source: GLEAN
Position: GCSC_132:344475..346624 (+ strand)
Length: 2150
>GLEAN_844 class=GenePrediction position=GCSC_132:343940..346624 (+ strand)
ATGCCCTCCGTTCCTTCGAGGCGTCCCCGACACGGTGAGACTGCTTGCGCAGCATTTTGACGTGGCAGCTAACTCTATCA
GATGCCAATTCGCATAGTCACTTGGAATGGTGAGTTGGTTTGTCGCGATAGTGTCTGTTGTTGCTCATCGCTGCTGCTTG
TTGTGTGTATTGCTGTCCTGTTCTGTCGTCTCATCTCTACGCTTCCTCTCACTAACGGCCAGTCAACGGGATCCGTAACC
CGTTCAAGTATGCGCCATGGAACAACGACAAAACCCTCCAGGTATGCCCTCTCCAATTATCCTCCATCTCCCTCCCATCT
CCACTTGCTAACCCCCTCTTTACTCAAGGCCATGTTCGACCGGCTCGACGCCGACATTGTCTGCTTCCAAGAGGTCAAGA
CGCCGAAACCGAGTCTGACCGACGACCTCGTCTTCATCCCCGGCTGGGATTCCTTTTACAGCTTTCCCCACAGCCAGACG
GGTGCGTCCGAATCCATCAGACAGAACACGCGAACACAGACCTAACGCAGACAAGGATACTCGGGCGTGTCGGTCTACAC
ACGCGACAGCTGCTGTGTGCCCACGCGCGTCGAAGAGGGCGTCACGGGCGTTTTGCGAGCACCGGGCACGACGACACGTT
ACATCGACCGGCCGGCCGACCGGCAGATCGGCGGCTACCCGACCGAACGCCAGCTGCAGTCGGCTGCCGTGGCACGTGAC
CTGATCGATGCCGAGGGCCGCTGCCTCGTGCTCGACTTTCCGCTCTTCGTGCTCATCAACGTCTACTGTCCGGCGCGCCG
CAACGATGACCGCACCGACTTCCGCGACGCCTTTCTGCTCGCTCTCGATGCCCGCGTGCGCAACCTCGTCGCTGCCGGTC
GCCACGTCGTCCTCTGCGGCGACATGAACACTATGCGCCATCACCTCGACACCGCGGCCGTCTGGGGTCACCATGGCCAG
GTCTTGCCGGCCGAGGCGCTTGCCTTTGATGAGGACTACCTCAGCCTCCGCTCGGCCGCCATCTTTGGCCGGCTGCTCTT
TGACGGCGACAGGATCACGAACACAACCACAGATATCCCCCCAAGCTCTCCTCCCATCCTCCACGACGCCTGTCGCGAGC
TGCACCCCCAGCGACGCGGCATGTACACCTGCTGGGACACGCGCAAGAATCACCGGCCGGCCAACTTTGGGTCTCGCATC
GACTTTGTCCTCTGCAGCCCCCGCCTGATGCAGCTCCTCGTCATCCAGGCCGACATCCAGCCCCAGCTGCTCGGCTCCGA
CCACTGCCCCGTCTACGTCGTTTTGCGCGACAGCGTCGACGACAATCGAAACGGCCAGGTCACCCACACCCTTCACACGC
TCGACTACCTTAACCCACCTGGTCGCTTTTCCGGTGGGCAGCTCGCCATGACCCCAGCACAGGACTTTGCGTTGCTGCAG
AGACGCCAGCCGCAATCGGCCCGCCGGATGCCTCAGTTCGCCAACAGACAGCACATTGGCAACCTGTTTCGTCGTGCCCC
CGCGGCCGGCGAGACTGCTGCTGCTGGGCCCTCATCCGAAGTTCGAAAACGGTGCGCTACAGAAGGCGAAACGGTGCGCG
AAGCGACTGCAGCCACGGCAAGCCAGCCGGTCAATCCGCGGCTGCCACCCCTGCTGCAGCCAGACCCTGTGGCCACTGTA
AGCGAGGAAGAGACGGGTGGCCGGCACTCGGTGGCGTCTGATAACGAGGCAGACGCAGTCGCAGCTGCTGAGAAGACCAA
CGACACTGGCAAGACGGATGAGACCCACACCACTTCAGAGACATTGTCTGTGCCAGACCCCGGTCACGATAATGCAGCTG
CATGCTTGCAGCACGCCACCACCTCTCACCCGCTGCGGCCTGCTGTCCTGATCCCCACCAACAGCCTGCAGCAGGCTGGA
AGTGGCCCTAAAGAGCCAATCGAAGACGGCCGCCTCGCGCGTGCGTCCACGTCTACATCCTCACCCTTGCCCACGCCCAC
ACCCACGCCCTCTTCCTTTCTGCAGCTAGCACAGGCGCAAGCCAAAAAAGTAAAACCCGACAGTCTGTCAAAGAAACGAA
GCGGCGCCCGATCCCTGTCGCTCTCGTCGTCCTCTGCAACCTCTTCGCCTGCACCTGCGCCTGCCTCCTCGACCGTCTCT
CCCTCGCGACCGGTCAAGAAGGCCAAGACCGGCATCCAGACGTCCATCAGCACCTTTCTACAGCCCCGACAGGGTCGTGG
GGAGACAGCCCCGTTAGGCGCTAAGACTGGCAGCGAGAAGAAAGCCCAGAGCCAGACTGGCCCGACTGCTGCTGACAGTA
GCAGGGTCCAGCCATCTCCCGACGACCCACCATTGTCGGCTGCAGACCTAGACGACAGGCCGGCATTGGTACCAGAACCC
GAACCTGCCCCAGGTAGCGAGAGTTTCTGGGCCGAGATCAACGATGGCGCCATGGCTGGCTGGTCAGCACTGGGTCTAGG
CCAGCGCCAGTCTCCCATGTGCGAGCATGGCGAGCCGTGTAAGATCTTTGTCACACGCAAGCCGGGCGTCAACAGCGGCC
GCTCCTTTTACATGTGTGCCCGACCACCAGGACCGCTGGGGCGACGGGAAAAGGGCACCGCCTGGCAGTGCACCACTTTC
TTCTGGTGTCGCGACTGGAAACCTGGCCGCAAAGAGAACGAGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62